Introduction

Rapid growth of the world population has led to a fast acceleration of food waste production1. The amount of food waste produced globally is reportedly 1.3 ~ 1.4 billion tons per year2. In China, 125 million tons of food waste were produced in 20203. Food waste contains an abundance of organic compounds, and the resource utilization of food waste has gradually become a global issue that needs to be urgently addressed4. Considering the negative impacts of incineration and landfill dumping on the disposal of food waste, anaerobic digestion has become one of the most promising options for recovering energy and materials5. During the anaerobic digestion process, the organic matter of food waste is converted to CH4 and CO2 by fermentative bacteria through the hydrolysis, acidogenesis, acetogenesis, and methanogenesis stages6.

Compared with those in other regions, the unique Chinese dietary habits result in a relatively higher oil content in Chinese food waste, ranging from 3 to 17% (wet basis)7. The collection of trapped oil and its illegal reutilization as cooking oil have serious health impacts8. Although the theoretical biogas conversion rate of oil (94.8%) is greater than that of protein (71%) and carbohydrates (50.4%)9, a high-oil content inhibits anaerobic digestion because of the accumulation of long-chain fatty acids (LCFAs)10. The oil is first hydrolyzed to glycerol and LCFAs in the absence of oxygen. LCFAs are the major intermediate products of oil biodegradation and are then further converted to acetate and hydrogen through the β-oxidation process by acetogenic bacteria and finally to CH4 by methanogenic archaea11. In an anaerobic environment, the adsorption of LCFAs onto the microbial surface forms blocking layers, affecting the transportation of nutrients to the cell12,13. Since a high-oil content has adverse effects on food waste anaerobic digestion, it is meaningful to explore the effective solution of high-oil food waste anaerobic digestion. Some research demonstrated that the mixing intensity control can disturb the solubility characteristics of oil, further improve the methane yield of high-oil food waste14. Recent studies indicated that the methane yield was enhanced from 438 mL/g-VS to 587 mL/g-VS as the oil contents increased, however when the oil content exceeded the limit, the system collapsed15. It has been also reported that the methane yield is improved through the co-digestion of oil and sludge16,17. Therefore, after being exposed for an adequate amount of time, anaerobic microbial communities may adapt to relatively high oil contents. Previous studies mainly focused on the performance of methane yield, the dynamic of microbial communities is seldom investigated.

Determination of the characteristics of microbial communities is important for improving the anaerobic digestion of high-oil food waste. Since many microbes that participate in anaerobic digestion construct a complex microbial community, it is difficult to analyze the detailed mechanism involved18. The different stages of anaerobic digestion are coordinated by abundant microbial communities that work in a symbiotic relationship. The microbial communities significantly fluctuate with changes in parameters such as pH, volatile fatty acids (VFAs), and substrate19. Fortunately, several molecular techniques are available for microbial community detection, and high-throughput sequencing (HTS) based on the 16 S rRNA gene is the most compelling method due to its high precision20. Studies have analyzed the shifts in microorganisms during the co-digestion of oil and sludge21,22. The roles of typical functional microbes in the anaerobic digestion process have been revealed23,24. However, shifts in microbial communities during the acclimation process have seldom been reported, and the mechanism by which microbes contribute to the system’s adaptation to high-oil conditions is not distinctly understood.

In this study, the aim was to investigate the detailed microbial community structure and diversity in the process of acclimatizing to high-oil food waste. The time profiles of VFAs and pH were analyzed to provide a biochemical context for the dynamic of microbial communities during the acclimation process. In addition, the differences in the anaerobic digestion of high-oil food waste by raw and acclimated sludge were also determined to demonstrate the effectiveness of acclimation.

Materials and methods

Properties of food waste and anaerobic sludge

Based on the general dietary habits of Chinese people, food waste for analysis was prepared according to the proportions of 45% vegetables, 35% rice, 16% pork and 4% soybean products. After mixing, the food waste was crushed by a food agitator. The oil contents were controlled by adding edible blended oil, which was composed of soybean oil, peanut oil, sesame oil, and flaxseed oils. The activated anaerobic sludge was obtained from the Qige sewage treatment plant in Hangzhou, China. For further testing, all samples were stored at 4 °C to improve repeatability. Table 1 displays the properties of the food waste and activated anaerobic sludge.

Table 1 Properties of food waste and activated anaerobic sludge.
Full size table

Acclimation process

A 60 L anaerobic incubator (COY Type A, USA) was used to incubate the activated anaerobic sludge. Continuous feeding of quantitative edible blended oil into the sludge for 30 days resulted in the oil content of the sludge reaching 10% (wet basis). For mesophilic anaerobic digestion, the anaerobic incubator must be kept at a constant temperature of 35 °C. The anaerobic incubator first received an injection of 2064 mg/L glucose, 3.75 mg/L NH4Cl, 16.45 mg/L KH2PO4 and mineral supplements to prevent any nutrient shortage25. The samples were collected from the incubator at different time intervals (10 days, 4 days, and 2 days) for further analysis of the microbial community, VFAs, and pH.

Anaerobic digestion batch tests

To explore the effects of oil contents on food waste anaerobic digestion, five 5 L anaerobic digesters were used to perform the batch tests. Initially, 1 L of activated anaerobic sludge was used to inoculate the digesters. Then, 2 L of food waste with various oil contents was added to the digesters. Because the average oil content of food waste in China is 10% 7 and the anaerobic digestion of food waste with 10% oil has good anaerobic biodegradability26, experiments were performed with wet basis oil contents of 0%, 2.5%, 5%, 7.5%, and 10%. The temperature was controlled by an external circulation heating system at 35 °C. A 50 rpm stirring device was used to complete the mixing process in the digesters. Biogas composition and production were measured daily.

Then, the acclimated sludge was used to digest high-oil food waste. 1 L of raw sludge or acclimated sludge was fed into each digester with 2 L of 10% oil food waste. The temperatures and stirring rates used in previous experiments were consistent. To measure VFAs, samples were collected from the digesters every 4 days. To verify the repeatability of the outcomes, three replicates of each sample were tested, and the average values were calculated.

Physicochemical analysis

According to the American Public Health Association (APHA) standard techniques27, the samples were oven dried at 105 ± 2 °C until constant weight, followed by incineration at 550 ± 10 °C for 4 h to determine total solids (TS) and volatile solids (VS). The pH was measured by a pH meter (Mettler FE28, Switzerland). The oil content was determined by extracting the oil from the samples with triolein28. The C/N ratio was calculated from the results of the ultimate analysis, which was conducted by an elemental analyzer (Thermo NA 2100, USA). A biogas analyzer (Geotech Biogas 5000, UK) was used to determine the composition of the biogas.

To determine the concentrations of various VFAs, a gas chromatograph (Shimadzu GC 2014 C, Japan) with flame ionization detector (FID) and AT-FFAP column (length 30 m, internal diameter 0.32 mm, and film thickness 0.5 μm) was used. The carrier gas was nitrogen at 50 mL/min flux. The temperatures of the injector and detector were controlled at 200 °C and 230 °C, respectively. The temperature of the oven was programmed at 110 °C initially, maintained for 2 min, increased at a rate of 10 °C/min to 190 °C and maintained for an additional 2 min. The injection volume of the sample was set at 1.0 µL25.

Microbial community analysis

The microbial community analysis of samples during the acclimation process were analyzed by HTS based on the 16 S rRNA gene. A commercial DNA extraction kit (Omega Soil DNA kit, USA) was used to extract DNA from the samples. The extracted DNA samples were stored at − 20 °C for further analysis. For bacterial 16 S rRNA polymerase chain reaction (PCR) amplification, the primers 515 F (GTGCCAGCMGCCGCGG) and 907R (CCGTCAATTCMTTTRAGTTT) were used, whereas for the archaeal sequence library, the primers 344 F (ACGGGGYGCAGCAGGCGCGA) and 915R (GTGCTCCCCCGCCAATTCCT) were used25. HTS was performed by Microeco Tech Co., Ltd. (Shenzhen, China) with an Illumina MiSeq sequencing system (Illumina, USA). To verify the repeatability of the results, three replicates of each sample were analyzed.

Results and discussion

Influence of oil contents on food waste anaerobic digestion

The fundamental experiments were performed to determine the influence of oil content on food waste anaerobic digestion. Figure 1(a) shows the cumulative methane yield of food waste with various oil contents. As the oil content increased from 2.5 to 5%, the cumulative methane production increased by 10.7% and 27.8% respectively compared to the blank group. The increase indicated that moderate oil addition contributed to methane production because of the hydrolysis of LCFAs29. However, further increases in oil content (7.5% and 10%) inhibited the methane yield compared to that in the 5% oil content group, indicating that excess LFCA hindered cellular permeability and mass transport. Specifically, compared with those of the blank group, the 7.5% and 10% oil contents increased the cumulative methane yield by 21.8% and 16.8%, respectively. The results revealed that oil addition was beneficial for biogas production, but the increase in methane yield decreased when the oil content exceeded 5%.

Fig. 1
figure 1

(a) The cumulative methane yield of food waste with different oil contents; (b) The daily methane yield of food waste with different oil contents.

Full size image

Figure 1(b) shows the daily methane yield of food waste with various oil contents. The peak of the daily methane yield was delayed as the oil content increased. The peaks of the 2.5%, 5%, 7.5%, and 10% oil content groups were delayed by 1, 2, 4, and 5 days, respectively, compared to those of the blank group. Additionally, the peak values of daily methane yield and convertibility reached a maximum at a 5% oil content.

The results indicated that oil addition improved the biogas yield due to its high methane production potential. The hydrolysis of oil generates LCFAs, which further produce methane30. However, oil addition also delayed the appearance of a daily methane yield peak, which was likely related to the transport limitation caused by bacteria being coated in a layer of LCFAs31.

Methane yield of the acclimated sludge

Figure 2 shows the effects of high-oil food waste anaerobically digested by acclimated and raw sludges. After 20 days, the cumulative methane yield of the acclimated sludge increased by 24.9% compared to that of the raw sludge. The peak of daily methane yield occurred 4 days earlier after acclimation, and the highest daily methane yield increased by 18.2%. The results indicated that the acclimated sludge adapted to the high-oil conditions and was beneficial for the resource utilization of high-oil food waste. Acclimation is a process that involves gradual adjustments within the microbial community modulated by gradual changes in the environment, improving microbial performance or survival32. As a result of acclimation, microorganisms were able to tolerate higher oil levels than unacclimated microorganisms. Thus, the efficiency of anaerobic digestion of high-oil food waste was obviously improved. However, the internal changes that occur during the acclimation process remain unclear. Hence, the dynamic of the microbial community was studied in the following text.

Fig. 2
figure 2

(a) Accumulative methane yield for the raw sludge and acclimated sludge; (b) daily methane yield for the raw sludge and acclimated sludge.

Full size image

Time profiles of VFA and pH during the acclimation process

The time profiles of VFA and pH were determined to validate the effectiveness of acclimation. Initially, the decomposition of oil produced LCFAs and VFAs, and LCFAs adhered to the surface of the methanogenic bacteria, inhibiting the activity of the methanogenic bacteria by attaching to cells and reducing mass transfer, ultimately leading to the accumulation of VFAs33. As microbial communities gradually adapt to high-oil conditions, LCFAs are converted to VFAs, and VFAs are rapidly consumed with the generation of acetic acid34. As shown in Fig. 3, the concentration of acetic acid significantly increased in the initial 20 days. On subsequent days, the concentrations of various VFAs remained stable. The time profile of pH is shown in Fig. 4. In the initial days, the pH decreased sharply due to the accumulation of VFAs. When the VFA concentration was maintained within a stable range in the later days, the pH also tended to stabilize. The time profiles of VFA and pH indicated that the acclimation was successful.

Fig. 3
figure 3

Time profile of VFAs during the acclimation process.

Full size image
Fig. 4
figure 4

Time profile of pH during the acclimation process.

Full size image

Dynamic of microbial community structure and diversity during the acclimation period

To determine the effect of acclimation, HTS based on the 16 S rRNA gene analysis was performed to investigate the dynamic of the microbial community. Figure 5 shows the shifts in the relative abundances of bacteria at the phylum level. The main phyla in the bacterial communities were Bacteroidetes, Firmicutes, Chloroflexi and Proteobacteria. During the acclimation process, Bacteroidetes and Firmicutes accounted for the largest proportion, and their relative abundance increased progressively. The most important contribution of Bacteroidetes to waste processing is carbohydrate hydrolysis into acetate, butyrate and propionic acid35. Whereas Firmicutes produce extracellular enzymes that primarily contribute to the biodegradation of macromolecular organics36. According to previous research, the Clostridiaceae, Syntrophomonadaceae, Syntrophaceae and Bacteroidaceae families are responsible for the biodegradation of LCFAs37,38. Among these bacteria, Clostridiaceae and Syntrophomonadaceae belong to the phylum Firmicutes, and Bacteroidaceae belongs to the phylum Bacteroidetes. This observation revealed that the abundances of nutrient-supplying and LCFA-degrading bacteria increased significantly with the progressive injection of oil, indicating that the anaerobic functional bacteria gradually adapted to the high-oil conditions and proliferated during the acclimation process.

Fig. 5
figure 5

Dynamic of bacterial communities at the phylum level.

Full size image
Fig. 6
figure 6

Dynamic of bacterial communities at the genus level.

Full size image

The 20 most prevalent genera identified in this study were chosen for heatmapping to analyze the potential roles of the bacterial taxa and the dynamic of the bacterial communities in detail, as presented in Fig. 6. The heatmap shows that whereas the relative abundance of Desulfovibrio decreased during acclimation, those of Anaerolinea, Clostridium and Longilinea increased. The shifts in the relative abundance of typical functional bacteria during acclimation are shown in Table 2. Anaerolinea is a genus in the phylum Chloroflexi, and when it is cultured with hydrogen-trophic methanogens, its growth rate increases significantly39. The phylum Firmicutes member Clostridium has the ability to produce organic acids40. Longilinea is a genus of the phylum Chloroflexi, and its most important role in waste processing is to metabolize different types of carbohydrates to generate organic acids41. Desulfovibrio is a genus of the phylum Thermodesulfobacteria, and it consists of sulfate-reducing bacteria42,43. During the acclimation period, the abundance of bacteria that biodegrade macromolecular organic matter increased, indicating that the microbial community had an enhanced ability to decompose macromolecular oil and LCFAs.

Table 2 Shifts in the relative abundance of typical functional bacteria during acclimation.
Full size table

The dynamic of archaeal communities at the genus level is illustrated in Fig. 7. The genus Methanobacterium accounted for the majority of the relative abundance, reaching approximately 80%. Methanobacterium belongs to the phylum Euryarchaeota and typically exists in anaerobic digestion reactors, the rumen, rice soil, rotten wood, etc. The major metabolic substrates of Methanobacterium are hydrogen, carbon dioxide, methanol, and formate44. The relative abundance of Methanobacterium declined during the initial 10 days of acclimation, probably due to the lack of required metabolic substrates. During the acclimation process, oil was gradually hydrolyzed into glycerol and fatty acids, while glycerol was further decomposed into hydrogen, carbon dioxide, and small organic acids. Therefore, the relative abundance of Methanobacterium gradually increased after 10 days. Methanosaeta is a genus of the phylum Euryarchaeota. It is an acetotrophic methanogenic archaea that typically exists in high-salt seafloor sediments, animal gastrointestinal tracts and anaerobic digestion reactors. The major metabolic substrate of Methanosaeta is acetic acid45. The hydrolysis of oil produces LCFAs, and the accumulation of LCFAs contributes to acidification to a certain extent46. Anaerobic bacteria tend to generate hydrogen under environmental acidification. Furthermore, the generated hydrogen was conducive to the growth of hydrogenotrophic methanogens and adverse to the growth of acetotrophic methanogens47,48. Thus, as acclimation progressed, the abundance of Methanosaeta gradually decreased.

Fig. 7
figure 7

Dynamic of archaeal communities at the genus level.

Full size image

The dynamic of the microbial community indicated that the acclimated sludge adapted to high-oil conditions, which is favorable for biogas production.

RDA (redundancy analysis) was used to visualize the correlations between the operational conditions (e.g. pH and oil content) and variations in microbial community (Fig. 8 ). The angle between the vector of pH and the vector of oil content is greater than 90◦, indicating that the effect of pH was negatively correlated with the effect of oil content. It also proved that the increase in oil content led to the accumulation of LCFA and a decrease in pH. At the same time, it can be seen that part of the microbial communities adapted to the high-oil environments and proliferated with acclimation; while another part of the microbial communities cannot adapt to the high-oil environments and gradually disappeared.

Fig. 8
figure 8

RDA analysis of microbial communities.

Full size image

Conclusions

The activated anaerobic sludge was acclimated to high-oil conditions. Compared with that of the raw sludge, the methane yield of the high-oil food waste anaerobically digested by the acclimated sludge improved by 24.9%. During acclimation, some functional bacterial taxa, such as Clostridium and Longilinea, which are able to degrade LCFAs and turn them into small organic molecules that have nutrient value for other bacteria, are allowed to proliferate. For the archaeal communities, the hydrogenotrophic methanogen Methanobacterium nearly supplanted the acetotrophic methanogen Methanosaeta. The time profiles of pH and VFA validated the success of acclimation. The findings of this study serve as a basis for emphasizing the effectiveness of acclimation and the dynamic of microbial communities and are able to provide an alternative solution to further high-oil waste management and resource utilization because the efficiency of anaerobic digestion for high-oil waste is obviously improved by acclimation.