Your privacy, your choice

We use essential cookies to make sure the site can function. We also use optional cookies for advertising, personalisation of content, usage analysis, and social media.

By accepting optional cookies, you consent to the processing of your personal data - including transfers to third parties. Some third parties are outside of the European Economic Area, with varying standards of data protection.

See our privacy policy for more information on the use of your personal data.

for further information and to change your choices.
Skip to main content
Download PDF

Sheep immune response against a novel recombinant enterotoxemia and infectious necrotic hepatitis vaccine in Türkiye

BMC Veterinary Research volume 21, Article number: 380 (2025) Cite this article

Abstract

Background

Clostridial diseases are common in ruminants all over the world. This study investigated the efficacy of a novel recombinant vaccine developed against enterotoxemia and infectious necrotic hepatitis in sheep.

Results

Plasmids carrying the Clostridium novyi type B alpha toxin gene (CnBtcn-alpha), Clostridium perfringens type C beta toxin gene (CpCcpb) and C. perfringens type D epsilon toxin gene (CpDetx) were constructed and the plasmids were transferred to Escherichia coli. Unpurified protein obtained from E. coli cell lysate supernatant was used to prepare the recombinant vaccine. The vaccine was prepared in three different formulas (RV100, RV200 and RV400), with 100, 200 and 400 µg of each protein in one vaccine dose. RV400 was preferred to immunise sheep as the antitoxin titres in the pooled blood serum of rabbits administered with this vaccine were determined to be above the minimum values specified in European Pharmacopoeia (10 IU/mL for beta, 5 IU/mL for epsilon, and 3.5 IU/mL for alpha). A total of 24 Akkaraman breed sheep with no antibodies against the relevant toxins were used for the experiment. All the animals in three groups (recombinant vaccine group, commercial polyvalent vaccine group and negative control group), each consisting of eight sheep, were vaccinated twice with an interval of 21 days and, the antitoxin titres were measured 14 days after the second vaccination by the mouse toxin neutralization test. The average antitoxin titres in sheep immunised with RV400 were calculated as 9.75 ± 1.28 IU/mL for C. perfringens beta, 13.75 ± 1.98 IU/mL for C. perfringens epsilon and 5.50 ± 0.93 IU/mL for C. novyi alpha toxins. On the other hand, the average values in sheep immunised with commercial vaccine were detected as 8.00 ± 2.14 IU/mL, 4.25 ± 1.67 IU/m L and 6.50 ± 0.93 IU/mL for C. perfringens beta, C. perfringens epsilon and C. novyi alpha, respectively. No antitoxin titre was detected in sheep in the negative control group (PBS). A statistically significant difference was observed between the recombinant and commercial vaccine groups in terms of C. perfringens epsilon antitoxin titres (P = 0.0002).

Conclusions

The present study was the first to investigate the efficacy of a combined recombinant vaccine prepared from unpurified proteins against enterotoxemia and infectious necrotic hepatitis and, the results suggested that it shows promise for protecting sheep against these diseases.

Peer Review reports

Background

Clostridial diseases are common in ruminants worldwide and cause high mortality rates [1]. Enterotoxemia is a disease characterised by toxaemia in sheep and lambs, but also in goats, cattle, pigs and horses [2]. Various types of Clostridium perfringens are involved in the aetiology of the disease. C. perfringens is divided into seven toxin types (A-G) according to the production of alpha, beta, epsilon, iota, enterotoxin and NetB toxins [3]. Type B causes lamb dysentery; type C causes enterotoxemia (struck) in lambs, sheep, goats, cattle, pigs and horses; type D causes enterotoxemia in sheep, goats and rarely in cattle. Enterotoxaemia caused by C. perfringens type D is also known overeating disease or pulpy kidney disease [2, 4]. Beta and epsilon toxins, which are the main virulence factors of C. perfringens types B, C and D, have lethal and necrotic effects [5]. Infectious necrotic hepatitis caused by C. novyi type B is an acute, toxaemic disease characterised by liver necrosis. Although the disease is usually seen in sheep, it can also be seen in cattle, pigs and horses [6, 7]. C. novyi type B produces alpha, beta and zeta toxins [8, 9]. Alpha toxin plays an active role in infectious necrotic hepatitis [10].

Conventional vaccines against clostridial infections in animals have been used for many years. However, recombinant vaccines using purified or unpurified recombinant proteins have recently been developed as an alternative to conventional vaccines [11,12,13,14,15,16,17,18]. It is reported that recombinant vaccines have some advantages such as little or no toxic effects, good immunogenicity, use of non-pathogenic strains and easy production on a large scale [1, 16, 19]. In order for recombinant vaccines to be widely used in veterinary medicine, their cost and effectiveness should be advantageous compared to conventional vaccines. The use of purified recombinant proteins in large-scale vaccine preparation increases the cost of vaccines. It has been reported that vaccines developed using unpurified recombinant proteins against botulism disease in animals produce higher antibody titres than conventional vaccines in previous studies [12, 13, 15]. To our knowledge, no studies are available investigating the efficacy of a combined recombinant vaccine using unpurified recombinant proteins against enterotoxemia or infectious necrotic hepatitis. This study was therefore carried out to investigate the effectiveness of a novel recombinant vaccine developed against enterotoxemia and infectious necrotic hepatitis in sheep.

Results

Expression and purification of recombinant protein

C. perfringens type C beta toxin gene (CpCcpb), C. perfringens type D epsilon toxin gene (CpDetx) and C. novyi type B alpha toxin gene (CnBtcn-alpha) cloned into the bacterial expression vector pET-28a (+) were cloned in Escherichia coli (E. coli) C43 (DE3) strain and confirmed with restriction endonucleases and primers (Fig. 1). Additionally, plasmids containing toxin genes were confirmed by sequence analysis. Expression of recombinant proteins was visualized by SDS-PAGE method using soluble and insoluble fractions of E. coli culture (Fig. 2). Recombinant strains were purified by nickel-nitrilotriacetic acid (Ni-NTA) spin kit (Qiagen - Germany, Cat. Number: 31314) (Fig. 3).

Fig. 1
figure 1

(a-c) Confirmation of plasmids containing toxin genes, analyzed on agarose gel 1%. (a) Lane M: DNA size marker; lane 1: negative colony; lane 2: negative colony; lane 3: pET-28a (+)-CpDetx plasmid digested by MluI and HindIII restriction enzymes. (b) Lane M: DNA size marker; lane 1: pET-28a (+)-CpCcpb plasmid confirmation by PCR primers. (c) Lane M: DNA size marker; lane 1: pET-28a (+)-CnBtcn-alpha plasmid confirmation by PCR primers

Full size image
Fig. 2
figure 2

(a-c) Expression of plasmids containing toxins stained with coomassie blue on sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) 10%. (a) Lane M: protein size marker; lane 1: non- transformed E. coli C43(DE3) strain; lane 2: water soluble components of the pET-28a (+)-CpDetx plasmid; lane 3: 8 M urea-soluble protein components of the pCpDetx plasmid constructed into the pVC-UGT plasmid containing the CpDetx toxin gene; lane 4: 8 M urea-soluble protein components of the pET-28a (+)-CpDetx. (b) Lane M: protein size marker; lane 1: non-transformed E. coli C43(DE3) strain; lane 2: water soluble components of the pET-28a (+)-CpCcpb plasmid; lane 3: 8 M urea-soluble protein components of the pCpCcpb plasmid constructed into the pVC-UGT plasmid containing the CpCcpb toxin gene; lane 4: 8 M urea-soluble protein components of the pET-28a (+)-CpCcpb plasmid. c) Lane M: protein size marker; lane C43(DE3): non-transformed E. coli C43(DE3) strain; lane 1: water soluble components of the pET-28a (+)-CnBtcn-alpha plasmid; lane 2: 8 M urea-soluble protein components of the pET-28a (+)-CnBtcn-alpha plasmid. The original gels are presented in additional file 1. The cropped areas of gel images were marked with a red box line

Full size image
Fig. 3
figure 3

(a-c) Ni-NTA purification of toxins with specific anti-His tag. (a) Lane M: protein size marker; lane 1: Filtrate product of the pET-28a (+)-CpDetx in E. coli C43(DE3) strain after digestion with Ni-NTA purification kit lysis buffer; lane 2: Filtrate product of the pET-28a (+)-CpDetx in E. coli C43(DE3) strain after the first precipitation through the column with the Ni-NTA purification kit; lane 3: Filtrate product of the pET-28a (+)-CpDetx in E. coli C43(DE3) strain after column washing with Ni-NTA purification kit; lane 4: Purified 1st eluate of the pET-28a (+)-CpDetx in E. coli C43(DE3) strain with Ni-NTA purification kit; lane 5: Purified second eluate of the pET-28a (+)-CpDetx in E. coli C43(DE3) strain with Ni-NTA purification kit. (b) Lane M: protein size marker; lane 1: Filtrate product of the pET-28a (+)-CpCcpb in E. coli C43(DE3) strain after digestion with Ni-NTA purification kit lysis buffer; lane 2: Filtrate product of the pET-28a (+)-CpCcpb in E. coli C43(DE3) strain after the first precipitation through the column with the Ni-NTA purification kit; lane 3: Filtrate product of the pET-28a (+)-CpCcpb in E. coli C43(DE3) strain after column washing with Ni-NTA purification kit; lane 4: Purified first eluate of the pET-28a (+)-CpCcpb in E. coli C43(DE3) strain with Ni-NTA purification kit. (c) Lane M: protein size marker; lane 1: Filtrate product of the pET-28a (+)-CnBtcn-alpha in E. coli C43(DE3) strain after digestion with Ni-NTA purification kit lysis buffer; lane 2: Filtrate product of the pET-28a (+)-CnBtcn-alpha in E. coli C43(DE3) strain after the first precipitation through the column with the Ni-NTA purification kit; lane 3: Filtrate product of the pET-28a (+)-CnBtcn-alpha in E. coli C43(DE3) strain after column washing with Ni-NTA purification kit; lane 4: Purified first eluate of the pET-28a (+)-CnBtcn-alpha in E. coli C43(DE3) strain with Ni-NTA purification kit

Full size image

Sterility and safety tests of recombinant vaccines

No microorganism growth was detected in the sterility test of the prepared recombinant vaccines during the 21-day period. In the safety test, no local or systemic reactions or deaths were observed.

Detection of antitoxin levels in vaccinated rabbits and sheep

Antitoxin titres detected for C. perfringens beta, C. perfringens epsilon and C. novyi alpha in the pooled blood sera of rabbits immunised with the recombinant vaccines (RV100, RV200 and RV400) prepared using unpurified protein obtained from E. coli cell lysate supernatant and a commercial vaccine were presented in Table 1. According to the European pharmacopoeia [20], antitoxin titres should not be less than 10 IU/mL, 5 IU/mL and 3.5 IU/mL for C. perfringens beta, C. perfringens epsilon and C. novyi alpha, respectively. 100 µg of all toxin proteins and 200 µg of C. perfringens beta and C. novyi alpha toxin proteins produced antitoxin titres lower than the minimum values specified in the European Pharmacopoeia. On the other hand, 400 µg of all toxin proteins and 200 µg of C. perfringens epsilon toxin protein produced adequate immune responses. No antitoxin titre was detected in rabbits in the negative control group (data not shown).

Table 1 Results of potency testing in rabbits
Full size table

The mean antitoxin titres detected against C. perfringens beta, C. perfringens epsilon and C. novyi alpha toxins in sheep vaccinated with RV400 were 9.75 ± 1.28 IU/mL, 13.75 ± 1.98 IU/mL and 5.50 ± 0.93 IU/mL, respectively. On the other hand, the mean antitoxin titres detected against C. perfringens beta, C. perfringens epsilon and C. novyi alpha toxins in sheep vaccinated with commercial vaccine were 8.00 ± 2.14 IU/mL, 4.25 ± 1.67 IU/mL and 6.50 ± 0.93 IU/mL, respectively (Table 2). No antitoxin titre was detected in sheep in the negative control group (data not shown). The difference between alpha (P = 0.1436) and beta (P = 0.1251) antitoxin titres in the recombinant and commercial vaccine groups was not statistically significant, but the difference between epsilon antitoxin titres was significant (P = 0.0002) (Fig. 4).

Table 2 Antitoxin titres determined in blood sera of sheep vaccinated with RV400 and commercial vaccine
Full size table
Fig. 4
figure 4

Antitoxin titres against C. perfringens beta (A) and C. perfringens epsilon (B) and C. novyi alpha (C) toxins in sheep immunised with commercial (CV) and recombinant (RV400) vaccines. Each data is shown as a dot in the whisker-plot graph. Comparison between groups was performed by Mann Whitney U test (P < 0.05)

Full size image

Discussion

Clostridial infections cause significant economic losses in animal husbandry all over the world [2]. The most effective way to protect animals from clostridial infections is vaccination. Commercial vaccines used to protect animals against diseases caused by clostridial agents such as C. botulinum, C. tetani, C. perfringens, C. sordellii, C. chauvoei, C. septicum and C. novyi are produced by conventional methods [7, 21]. Although existing commercial vaccines create an adequate immune response, recombinant vaccines have been reported to be more advantageous in terms of cost and easy production [1, 16, 19]. In the present study, combined recombinant vaccines were prepared for the first time by using different concentrations (100, 200 and 400 µg) of unpurified protein obtained from E. coli cell lysate supernatant against enterotoxemia and infectious necrotic hepatitis diseases and, the level of humoral immune response in vaccinated sheep was measured.

According to the European Pharmacopoeia, potency testing of C. perfringens and C. novyi vaccines to be used for immunisation of target animals should be performed using pooled sera of rabbits. In the potency testing of rabbits, 100 µg of all three recombinant proteins and 200 µg of C. novyi alpha and C. perfringens beta toxin proteins did not produce an adequate immune response. However, the titres obtained in rabbits immunised with RV400 for C. novyi alpha (8 IU/mL) and C. perfringens beta (12 IU/mL) antitoxins were above the minimum values specified in the European Pharmacopoeia. On the other hand, antitoxin titres of 8 IU/mL and 20 IU/mL were detected for C. perfringens epsilon protein in pooled blood sera of rabbits immunised with RV200 and RV400, respectively. These values were above the minimum value (5 IU/mL) specified for epsilon antitoxin in the European Pharmacopoeia. Antitoxin titres against C. perfringens beta, C. perfringens epsilon and C. novyi alpha toxins in pooled blood sera of rabbits vaccinated with commercial vaccine were determined as 10 IU/mL, 6 IU/mL and 10 IU/mL, respectively. Since antitoxin was produced at a protective level against all of the related toxins in rabbits immunised with RV400, this vaccine formula was used to immunise sheep.

In this study, RV400 vaccine caused lower levels of neutralising antibodies in sheep when compared with rabbits. Similar to our findings, previous studies reported that conventional and recombinant clostridial vaccines produced higher antitoxin titres in rabbits than in ruminant species [22, 23]. In a study by Salvarini et al. [24], it was reported that the bivalent vaccine prepared using recombinant alpha and beta toxin proteins of C. perfringens produced 9.6 IU/mL and 20.4 IU/mL neutralising antibodies against alpha and beta toxins in rabbits and 6 IU/mL and 14.5 IU/mL in pigs, respectively. Recombinant botulism vaccines have been reported to produce 10 IU/mL neutralising antibodies against C. botulinum type D in guinea pigs and 6.14 IU/mL in cattle [25, 26]. On the other hand, Chadran et al. [27] reported that the combined vaccine prepared using recombinant epsilon toxin protein of C. perfringens and attenuated sheep smallpox virus produced approximately the same level (8 IU/mL) of epsilon antitoxin titre in rabbits and sheep. It should be underlined that immunological and body weight differences between animal species might be responsible for the differences in antitoxin titres [15]. Interestingly, recombinant epsilon protein induced a stronger immune response than other proteins, both in rabbits and sheep. Similarly, previous studies [18, 22] have also reported that the recombinant vaccine induced higher levels of neutralising antibodies against epsilon toxin than beta toxin in cattle. A detailed investigation is needed to understand why the epsilon toxin protein reveals a stronger immune response.

In previous studies, clostridial vaccines were prepared using unpurified [12,13,14,15,16, 28] and purified recombinant proteins [11, 18, 24, 29, 30]. Purification of recombinant proteins is carried out by chromatography, which is a cost-increasing factor in large-scale vaccine production. Therefore, the use of purified recombinant proteins for vaccine production has not been found plausible in veterinary medicine [31, 32]. The vaccine prepared from unpurified recombinant proteins was observed to produce higher beta and epsilon antitoxin titres in sheep than the commercial vaccine employed in the present study. This may be explained by the fact that recombinant vaccine contains more specific proteins that stimulate the immune system with less antigenic competition. On the other hand, conventional polyvalent vaccines contain a large number of structurally related antigens from different microorganism species which may lead to more antigenic competition [33]. Consistent with our findings, previous studies have also reported that recombinant toxin vaccines developed against clostridial infections in animals produce higher antibody titres than conventional vaccines [12,13,14,15,16, 18, 22, 29].

One of the striking results of the study was that RV400 vaccine induced a lower immune response against C. novyi alpha toxin when compared with the commercial vaccine. This is thought to be due to the transfer of a partial of the alpha toxin gene to the plasmid vector instead of the whole gene. Although the beta (1011 bp) and epsilon (987 bp) toxin genes of C. perfringens were successfully transferred to plasmids constructed in our laboratory, the C. novyi alpha toxin gene (6576 bp) could not be transferred to the plasmid vector as a whole probably due to the size of the gene. It has been reported that the genetic material of Clostridium species is difficult to easily transfer into cells using conventional plasmid vectors and electroporation techniques [34]. The entire C. novyi alpha toxin gene has not been cloned so far. However, a part of the gene encoding highly epitopic regions of alpha toxin has been cloned before and, alpha toxin-specific antibodies have been produced in mice and rabbits immunised with the recombinant proteins obtained [35, 36]. Alpha toxin of C. novyi consists of 2178 amino acids. The N-terminal part of the toxin contains approximately 550 aminosides and this part shows enzymatic activity. The C-terminal part has antigenic activity and is the part where the toxin binds to receptors [10]. In the present study, a 570 bp long nucleotide sequence encoding a large number of epitope regions in the C-terminal part of alpha toxin was transferred to plasmid and the recombinant proteins obtained produced immune response against alpha toxin, though not at a desired level.

It is reasonable that the level of immune response increases as the amount of proteins used in the production of recombinant vaccines increases. In the present study, although desirable results were obtained with 400 µg of all the recombinant proteins, adequate immune responses were not produced by the administration of 100 µg of the all recombinant proteins and 200 µg of C. perfringens beta and C. novyi alpha toxin proteins. Most of the previous studies testing various amounts of proteins in recombinant vaccines prepared for C. perfringens toxins in different animal species have generally reported that sufficient protection was observed with the amount of 200 µg and above [18, 22, 24, 37]. However, an amount of 100 µg recombinant protein has been showed to induce sufficient protection in rabbits and sheep in several studies [11, 38]. The use of purified or unpurified proteins and type of adjuvant might play role in these differences. Aluminum-based adjuvants have been reported as the safest, and have the best efficacy due to the triggering of a strong humoral response [39]. Al(OH)3 is the most commonly used adjuvant in recombinant vaccines against clostridial diseases [19, 29, 40, 41]. In the present study, recombinant vaccines were prepared from unpurified proteins using Al(OH)3 as adjuvant. It is plausible to suggest that in addition to specific proteins, other proteins can be present in the total amount of unpurified protein. Therefore, the low amount of specific proteins in the vaccine may cause low levels of neutralising antibodies to be produced. It is also reported that the type of adjuvant used in recombinant vaccines may affect the amount of antibody formed [28]. As a matter of fact, Moreira Jr. et al. [42] reported that the recombinant botulism vaccine containing Montanide ISA 50 adjuvant produced higher antitoxin titre than the vaccine containing Al(OH)3.

Conclusion

Conventional vaccines are commercially produced against clostridial infections such as enterotoxemia, blackleg, infectious necrotic hepatitis, bacillary haemoglobinuria, tetanus, braxy and gas gangrene in animals. In this study, a combined recombinant vaccine against enterotoxemia and infectious necrotic hepatitis diseases using unpurified recombinant proteins was developed for the first time as an alternative to the existing conventional vaccines and, tested in sheep. It was demonstrated that the vaccine prepared using 400 µg amounts of unpurified recombinant C. novyi alpha, C. perfringens beta and epsilon toxin proteins produced an adequate immune response in sheep. Because recombinant vaccines are prepared more quickly, easily and potentially at a lower cost, it was suggested that they can be used successfully against enterotoxemia and infectious necrotic heptatis diseases. However, comprehensive studies are needed to investigate the duration of immunisation of recombinant vaccines in target animals and to determine the effectiveness of recombinant vaccines prepared using different adjuvants. In addition, different epitope regions forming the toxin gene of C. novyi should be cloned into separate plasmids and the immunogenic properties of the toxins formed by each region should be examined separately.

Materials and methods

Kits, enzymes and reagents

The pVC-UGT (constructed for another study), pET-28a (+) plasmids and E. coli C43 (DE3) strains were prepared from the Synthetic Biology and Metabolic Engineering Laboratory at Firat University (Türkiye). The EcoRI, SalI, XhoI, HindIII, and MluI restriction enzymes (NEB, ABD) were used for cloning the epsilon, beta and alpha toxin genes into the pET-28a (+) plasmid. “QIAprep Spin Miniprep Kit (Catalog Number: 27106)” used for plasmid DNA isolation and “QIAquick Gel Extraction Kit (Catalog Number: 28706)” used for purification of polymerase chain reaction (PCR) products after agarose gel electrophoresis were supplied by QIAGEN (Germany). “E.Z.N.A Bacterial DNA Kit (Cat. Number: D3350-00)” used for genomic DNA (gDNA) isolation was supplied by OMEGA and “1 kb DNA Ladder (Catalog Number: MG-LDR-1000)” used for determination of molecular weights of DNA bands during agarose gel electrophoresis was supplied by Thermo. 50xTAE Buffer Solution (Tris-Acetate-EDTA) used for agarose gel electrophoresis was supplied by Fisher Scientific. dNTP, NAD+ (β-Nicotinamide adenine dinucleotide), T5 exonuclease, phusion polymerase, Taq ligase solutions used for the Gibson assembly method were supplied by NEB, and trisma base chemicals were supplied by Sigma, HCl solution and MgCl2 were supplied by Merck, nuclease free water was supplied by Wisent Canada, Difco SOB medium (Super Optimal Broth) used for the transformation step was supplied by BD Difco, and glucose was supplied by Wisent Canada.

Vaccine strains and standard toxins

C. novyi type B (Genbank: JENV01000129.1), C. perfringens type C (NCBI Reference Sequence: NZ_ABDU01000064.2) and C. perfringens type D (NCBI Reference Sequence: NZ_VFIZ01000005.1) vaccine strains and standard toxins used in the mouse toxin neutralisation test were purchased from Pendik Veterinary Control Institute (Türkiye).

Constructions of recombinant CpDetx, CpCcpb, CnBtcn-alpha plasmids

Construction of CpDetx plasmid

The CpDetx toxin gene, obtained from the previously constructed [43] pCpDetx plasmid (CpDetx in pVC-UGT plasmid) with EcoRI and SalI restriction enzymes, was constructed by ligation to the pET-28a (+) plasmid to which the sticky end was created with EcoRI and XhoI restriction enzymes. The construction was transformed into the E. coli C43(DE3) through the electroporation method.

Construction of CpCcpb plasmid

The CpCcpb toxin gene was amplified from C. perfringens type C genomic DNA by PCR using a pair of primers (5’-GCGAATTCCTCGAGGGTACCATGAAGAAAAAATTTATTTCATTAG-3’ and 5’– GCCTGCAGGTCGACTCTAGAAATAGCTGTTACTTTGTGAGTAAG-3’). The reaction was performed with 0.5 µM of each primer and 50 ng of genomic DNA (pre-denaturation at 98 °C for 30 s, followed by denaturation at 98 °C for 10 s, annealing at 63 °C for 30 s, and extension at 72 °C for 20 s for 35 cycles, with a final extension at 72 °C for 5 min.) in a total volume of 50 µl. The PCR product was subjected to electrophoresis with 1% agarose gel and staining with ethidium bromide. Following the purification from the gel, the CpCcpb toxin gene was obtained by digestion with EcoRI and SalI restriction enzymes. The obtained CpCcpb toxin gene was ligated into the pET-28a (+) plasmid constructed with the sticky end EcoRI and XhoI restriction enzymes. The construction was transformed into the E. coli C43(DE3) through the electroporation method.

Construction of CnBtcn-alpha plasmid

The CnBtcn-alpha toxin gene was amplified from C. novyi type B genomic DNA by PCR using a pair of primers (5’- TGGTGGTGCTCGACTCTAGATTCTTCCCAATTTCCGTTTATATTATC − 3’ and 5’- TCCGAATTCCTCGAGGGTACCAATGGAGAGCTTCATTACAAAAATATAC − 3’). The reaction was performed with 0.5 µM of each primer and 50 ng of genomic DNA (pre-denaturation at 98 °C for 30 s, followed by denaturation at 98 °C for 10 s, initial temperature of 70 °C for 4 s decreasing by 0.1 °C per cycle (or ramp rate of 0.1 °C per cycle) until reaching 67 °C, then holding at 67 °C for 20 s for annealing, and extension at 72 °C for 35 s for 35 cycles, with a final extension at 72 °C for 5 min.) in a total volume of 50 µl. The PCR product was subjected to electrophoresis with 1% agarose gel and staining with ethidium bromide, followed by purification from the gel. For cloning into pET-28a (+) plasmid, pET-28a (+)-CpDetx plasmid was amplified by PCR using a pair of primer (5’-TTGTAATGAAGCTCTCCATTGGTACCCTCGAGGAATTCGGATCC-3’ and 5’- TAAACGGAAATTGGGAAGAATCTAGAGTCGAGCACCACCACCAC-3’). The reaction was performed with 0.5 µM of each primer and 50 ng of genomic DNA (pre-denaturation at 98 °C for 30 s, followed by denaturation at 98 °C for 10 s, initial temperature of 70 °C for 4 s decreasing by 0.1 °C per cycle (or ramp rate of 0.1 °C per cycle) until reaching 67 °C, then holding at 67 °C for 20 s for annealing, and extension at 72 °C for 35 s for 35 cycles, with a final extension at 72 °C for 6 min and 20 s) in a total volume of 50 µl. The PCR product was subjected to electrophoresis with 1% agarose gel and staining with ethidium bromide, followed by purification from the gel. The obtained fragments were combined using the Gibson method [44]. The construction was transformed into the E. coli C43(DE3) through the electroporation method.

Expression and purification of the recombinant proteins

E. coli C43(DE3) strains containing pET-28a (+) plasmids carrying CpDetx, CpCcpb, CnBtcn-alpha toxin genes were grown in LB containing 30 mg/mL kanamycin. When the OD600 value of the culture reached the range of 0.6–0.8, it was induced with Isopropyl β-D-1-thiogalactopyranoside (IPTG) with a final concentration of 1 mM. After 16 h, the pellet of the culture was collected by centrifugation (4000 x rpm; 20 min; 4 °C), suspended in 8 M urea and sonicated for 10 s at 60 kHz, 3 times, and collected by centrifugation (4000 x rpm; 20 min; 4 °C). The expressions of the proteins were confirmed by 12% SDS-PAGE and their amounts were measured using Lowry method as 39.298 µg/mL, 3.996 µg/mL, 8.420 µg/mL, respectively.

Experimental animals

New Zealand rabbits aged 3–6 months used in the potency test and mice (Swiss albino) weighing 18–20 g used in the toxin neutralisation test were obtained from the Experimental Animals Unit of Elazığ Veterinary Control Institute. Akkaraman breed sheep (1–2 years old) were obtained from the Agriculture and Livestock Research Centre of Fırat University. Ethical approval for experimental studies on animals was obtained from the Local Ethics Committee for Animal Experiments of Elazığ Veterinary Control Institute (Approval no. 2021/05).

Vaccine preparation and safety

Unpurified protein obtained from E. coli cell lysate supernatant was used for vaccine preparation. Three different recombinant vaccines (RV100, RV200, RV400) were prepared with 100, 200 and 400 µg each of C. novyi alpha, C. perfringens beta and C. perfringens epsilon proteins in each vaccine dose (2 mL). Aluminum hydroxide [2.5–3.5% Al (OH)3] was used as adjuvant [18]. For sterility of the vaccine, 0.5 mL of the vaccine formula was transferred into thioglycolate and Sabouraud broths. Thioglycolate broths were incubated under aerobic and anaerobic conditions at 37 °C and Sabouraud broths were incubated under aerobic conditions at 25 °C. Growth was checked daily for 21 days by spectrophotometry [22]. The safety test was performed as described in the European Pharmacopoeia [20].

Potency test in rabbits

The potency test was performed using New Zealand rabbits that did not carry antibodies against the relevant toxins [22, 27]. The number of rabbits (n = 35) was determined with an effect size of 0.71, an alpha error of 0.05 and a power of 85% using the G*Power package program (Version 3.1. 9.2). Five groups were formed with 7 rabbits in each group: RV100 (G1), RV200 (G2), RV400 (G3), Commercial Vaccine-CV (G4) and negative control (G5). Rabbits from G1, G2 and G3 were vaccinated subcutaneously with 2 mL of recombinant vaccines RV100, RV200 and RV400 (concentrations of 100, 200 and 400 µg), respectively. Rabbits from G4 were vaccinated subcutaneously with 2 mL of commercial vaccine. Rabbits from G5 received 2 mL of PBS. After 21 days, the rabbits were revaccinated with the same dose. Blood was collected from the rabbits 14 days after the second vaccination and sera were removed and pooled serum samples were obtained for each group. The antitoxin level in the pooled rabbit blood sera was determined by the mouse toxin neutralisation test [20, 24]. Briefly, serum dilutions (from 1:1 to 1:32) and standard toxin mixes were incubated at 37 °C for 1 h for neutralisation, 0.2 mL of C. novyi alpha toxin and serum dilution mixtures were administered intramuscularly to 2 mice, 0.2 mL of C. perfringens beta and epsilon toxin and serum dilution mixtures were administered intravenously to 2 mice. The number of mice was determined based on the recommendation of the European Pharmacopoeia that suggests the use of at least two mice for serum dilutions and standard toxin mixes (for C. perfringens and C. novyi vaccines) [20]. The mice were observed for 72 h, and the number of dead and surviving animals was recorded. The 50% neutralization titre was calculated according to the method reported by Reed and Muench [45] and expressed in international units per milliliter (IU/ mL).

Immunization of sheep

The number of sheep was determined to be 24 sheep in total with an effect size of 0.78, an alpha error of 0.05 and a power of 85% using the G*Power package program (Version 3.1. 9.2). Twenty four sheep without detectable antibody levels against C. novyi alpha, C. perfringens beta and epsilon toxins were divided into 3 groups containing 8 sheep each (RV400, CV and negative control group). RV400 vaccine was used for immunisation of sheep because the antitoxin titers in pooled blood sera of rabbits given vaccine containing 400 µg of each recombinant protein were found to be above the limits specified in European Pharmacopoeia. The animals in the RV400 and CV groups were vaccinated twice by inoculating 2 mL of vaccine at 21-day intervals, while those in negative control group received 2 mL of PBS. Blood was collected from the sheep 14 days after the second inoculation and the antitoxin titres in individual blood sera were determined by the mouse toxin neutralisation test.

Statistical analysis

SPSS statistical package programme [46] was used to evaluate the study data. Pairwise comparisons of the groups were evaluated by the two-tailed Mann Whitney U test. Statistical significance level was accepted as P < 0.05.

Data availability

No datasets were generated or analysed during the current study.

References

  1. Khiav LA, Zahmatkesh A. Vaccination against pathogenic clostridia in animals: a review. Trop Anim Health Prod. 2021;53:284.

    Article  Google Scholar 

  2. Uzal FA, Prescott JF, Songer JG, Popoff MR, editors. Clostridial diseases of animals. Wiley Blackwell; 2016.

  3. Rood JI, Adams V, Lacey J, Lyras D, McClane BA, Melville SB, et al. Expansion of the Clostridium perfringens toxin-based typing scheme. Anaerobe. 2018;53:5–10.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  4. Uzal FA. Diagnosis of Clostridium perfringens intestinal infections in sheep and goats. Anaerobe. 2004;10:135–43.

    Article  CAS  PubMed  Google Scholar 

  5. Uzal FA, Songer JG. Diagnosis of Clostridium perfringens intestinal infections in sheep and goats. J Vet Diagn Invest. 2008;20:253–65.

    Article  PubMed  Google Scholar 

  6. Nyaoke AC, Navarro MA, Beingesser J, Uzal FA. Infectious necrotic hepatitis caused by Clostridium novyi type B in a horse: case report and review of the literature. J Vet Diagn Invest. 2018;30:294–99.

    Article  PubMed  Google Scholar 

  7. Zaragoza NE, Orellana CA, Moonen GA, Moutafis G, Marcellin E. Vaccine production to protect animals against pathogenic clostridia. Toxins. 2019;11:525.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  8. Navarro MA, Uzal FA. Pathobiology and diagnosis of clostridial hepatitis in animals. J Vet Diagn Invest. 2020;32:192–202.

    Article  CAS  PubMed  Google Scholar 

  9. Jeong CG, Seo BJ, Nazki S, Jung BK, Khatun A, Yang MS, et al. Characterization of Clostridium novyi isolated from a sow in a sudden death case in Korea. BMC Vet Res. 2020;16:1–9.

    Article  Google Scholar 

  10. Busch C, Schömig K, Hofmann F, Aktories K. Characterization of the catalytic domain of Clostridium novyi alpha-toxin. Infect Immun. 2000;68:6378–83.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  11. Milach A, de los Santos JRG, Turnes CG, Moreira ÂN, de Assis RA, Salvarani FM, et al. Production and characterization of Clostridium perfringens recombinant β toxoid. Anaerobe. 2012;18:363–65.

    Article  CAS  PubMed  Google Scholar 

  12. Moreira C Jr, da Cunha CEP, Moreira GMSG, Mendonça M, Salvarani FM, Moreira AN, et al. Protective potential of recombinant non-purified botulinum neurotoxin serotypes C and D. Anaerobe. 2016;40:58–62.

    Article  CAS  PubMed  Google Scholar 

  13. Moreira C Jr, Ferreira MR, da Cunha CEP, Donassolo RA, Finger PF, Moreira GMSG, et al. Immunogenicity of a bivalent non-purified recombinant vaccine against botulism in cattle. Toxins. 2018;10:381.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  14. Moreira C Jr, Ferreira MR, Finger PF, Magalhaes CG, da Cunha CEP, Rodrigues RR, et al. Protective efficacy of recombinant bacterin vaccine against botulism in cattle. Vaccine. 2020;38:2519–26.

  15. Otaka DY, Barbosa JD, Moreira C, Ferreira MR, Cunha CE, Brito AR, et al. Humoral response of buffaloes to a recombinant vaccine against botulism serotypes C and D. Toxins. 2017;9:297.

    Article  PubMed  PubMed Central  Google Scholar 

  16. Otaka DY, Barbosa JD, de Souza LA, Moreira C Jr, Ferreira MR, Donassolo RA, et al. Recombinant vaccine against botulism in buffaloes: evaluation of the humoral immune response over 12 months. Anaerobe. 2020;63:1–6.

    Article  Google Scholar 

  17. Wang Y, Miao Y, Hu LP, Kai W, Zhu R. Immunization of mice against alpha, beta, and epsilon toxins of Clostridium perfringens using recombinant rCpa-bx expressed by Bacillus subtilis. Mol Immunol. 2020;123:88–96.

    Article  CAS  PubMed  Google Scholar 

  18. Galvao CC, Barbosa JD, Oliveira CMC, Otaka DY, Silva PRO, Ferreira MRA, et al. Measurement over 1 year of neutralizing antibodies in cattle immunized with trivalent vaccines recombinant alpha, beta and epsilon of Clostridium perfringens. Toxins. 2021;13:594.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  19. Ferreira MRA, Moreira GMSG, Cunha CEPD, Mendonça M, Salvarani FM, Moreira AN, et al. Recombinant alpha, beta, and epsilon toxins of Clostridium perfringens: production strategies and applications as veterinary vaccines. Toxins. 2016;8:340.

    Article  PubMed  PubMed Central  Google Scholar 

  20. Anonymous. European Pharmacopoeia, 9th Edition, Strasbourg, France; 2017.

  21. Elsify AM, Mousa WS, Nayel MA, Abdeen EE, Salama AA, Sherif HR, et al. Field evaluation of three commercial polyvalent clostradial vaccines used in sheep. Alex J Vet Sci. 2017;52:57–60.

    Google Scholar 

  22. Moreira GMSG, Salvarani FM, da Cunha CEP, Mendonça M, Moreira AN, Gonçalves LA, et al. Immunogenicity of a trivalent recombinant vaccine against Clostridium perfringens alpha, beta, and epsilon toxins in farm ruminants. Sci Rep. 2016;6:1–9.

    Article  Google Scholar 

  23. Silva ROS, Duarte MC, Junior CAO, de Assis RA, Lana AMQ, Lobato FCF. Comparison of humoral neutralizing antibody response in rabbits, guinea pigs, and cattle vaccinated with epsilon and beta toxoids from Clostridium perfringens and C. botulinum types C and D toxoids. Anaerobe. 2018;54:19–22.

    Article  CAS  PubMed  Google Scholar 

  24. Salvarani FM, Conceicao FR, Cunha CE, Moreira GMSG, Pires PS, Silva RO, et al. Vaccination with recombinant Clostridium perfringens toxoids α and β promotes elevated antepartum and passive humoral immunity in swine. Vaccine. 2013;31:4152–55.

    Article  CAS  PubMed  Google Scholar 

  25. Cunha CEP, Moreiraa GMSG, Salvarani FM, Neves MS, Lobato FCF, Dellagostina OA, et al. Vaccination of cattle with a recombinant bivalent toxoid against botulism serotypes C and D. Vaccine. 2014;32:214–16.

    Article  PubMed  Google Scholar 

  26. Gil LAF, Cunha CEP, Moreira GMSG, Salvarani FM, Assis RA, Lobato FCF, et al. Production and evaluation of a recombinant chimeric vaccine against Clostridium botulinum neurotoxin types C and D. PLoS ONE. 2013;8:e69692.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  27. Chandran D, Naidu SS, Sugumar P, Rani GS, Vijayan SP, Mathur D, et al. Development of a recombinant epsilon toxoid vaccine against enterotoxemia and its use as a combination vaccine with live attenuated sheep pox virus against enterotoxemia and sheep pox. Clin Vaccine Immunol. 2010;17:1013–16.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  28. Peng X, Li X, Peng G, Feng L, Jiang Y, Luo Y. Recombinant unpurified rETXH106P/ CTB-rETXY196E protects rabbits against Clostridium perfringens epsilon toxin. J Vet Med Sci. 2021;83:441–46.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  29. Freitas NFQR, Otaka DY, Galvao CC, de Almeida DM, Ferreira MRA, Junior CM, et al. Humoral immune response evaluation in horses vaccinated with recombinant Clostridium perfringens toxoids alpha and beta for 12 months. Toxins. 2021;13:566.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  30. John FA, Criollo V, Gaghan C, Armwood A, Holmes J, Thachil AJ, et al. Immunization of Turkeys with Clostridium septicum alpha toxin-based recombinant subunit proteins can confer protection against experimental clostridial dermatitis. PLoS ONE. 2024;19(4):e0302555.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  31. Heldens JGM, Patel JR, Chanter N, Ten Thij GJ, Gravendijck M, Schijns VEJC, et al. Veterinary vaccine development from an industrial perspective. Vet J. 2008;178:7–20.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  32. Moreira GMSG, Cunha CEP, Salvarani FM, Gonçalves LA, Pires PS, Conceição FR, et al. Production of recombinant botulism antigens: a review of expression systems. Anaerobe. 2014;28:130–36.

    Article  CAS  PubMed  Google Scholar 

  33. Hunt JD, Jackson DC, Brown LE, Wood PR, Stewart DJ. Antigenic competition in a multivalent foot rot vaccine. Vaccine. 1994;12:457–64.

    Article  CAS  PubMed  Google Scholar 

  34. Staedtke V, Roberts NJ, Bai RY, Zhou S. Clostridium novyi-NT in cancer therapy. Genes Dis. 2016;3:144–52.

  35. Mehrvarz M, Najafi MF, Salehi TZ, Majidi B. Cloning and expression of a fusion protein containing highly epitopic regions of Clostridium perfringens epsilon toxin and Clostridium novyi alpha toxin. J Cell Mol Res. 2021;12:56–64.

    CAS  Google Scholar 

  36. Noshahrı NG, Najafi MF, Kakhki A, Majidi B, Mehrvarz M. Identification and cloning of highly epitopic regions of Clostridium novyi alpha toxin. Turkish J Biol. 2016;40:1219–26.

    Article  Google Scholar 

  37. Jiang Z, De Y, Chang J, Wang F, Yu L. Induction of potential protective immunity against enterotoxemia in calves by single or multiple recombinant Clostridium perfringens toxoids. Microbiol Immunol. 2014;8:621–27.

    Article  Google Scholar 

  38. Du J, Liu B, Wang T, Zhu Z, Yin C, Luo Y, et al. A non-toxic recombinant bivalent chimeric protein rETXm3CSAm4/TMD as a potential vaccine candidate against enterotoxemia and braxy. Vaccine. 2023;41:1232–38.

    Article  CAS  PubMed  Google Scholar 

  39. Martinon S, Cisneros A, Villicana S, Hernandez-Miramontes R, Mixcoha E, Calderon-Vargas P. Chemical and immunological characteristics of aluminum-based, oil-water emulsion, and bacterial-origin adjuvants. J Immunol Res. 2019;3974127.

  40. Rodrigues RR, Motta JF, Ferreira MRA, Moreira C Jr, Alves MLF, Costa AV, et al. Immunization of sheep with a recombinant vaccine containing immunogenic nontoxic domains of Clostridium perfringens alpha and beta toxins. Microb Pathog. 2023;182:106269.

    Article  Google Scholar 

  41. Choi ES, Pyo SW, Kim SH, Jeon JH, Rhie GE, Yun MR, et al. Development of a recombinant fusion vaccine candidate against lethal Clostridium botulinum neurotoxin types A and B. Vaccines. 2025;13:39.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  42. Moreira C Jr, Rodrigues RR, Cunha CEP, Donassolo RA, Ferreira MRA, Finger PF, et al. Evaluation of long-term immune response in cattle to botulism using a recombinant E. coli bacterin formulated with Montanide™ ISA 50 and aluminum hydroxide adjuvants. Microb Pathog. 2024;189:106596.

    Article  CAS  PubMed  Google Scholar 

  43. Oz E. Heterologous microbial biocynthesis of saffron apocarotenoids using zeaxanthin previous substance. Master’s thesis, Firat University, Graduate School of Natural and Applied Sciences, Elazığ, 2019.

  44. Gibson DG, Young L, Chuang RY, Venter JC, Hutchison CA, Smith HO. Enzymatic assembly of DNA molecules up to several hundred kilobases. Nat Methods. 2009;6:343–45.

    Article  CAS  PubMed  Google Scholar 

  45. Reed R, LJ, Muench H. A simple method for estimating 50% end points. Am J Hyg. 1938;27:493–7.

    Google Scholar 

  46. IBM, C. IBM SPSS statistics for Windows, Versiyon 22.0, Armonk (NY): IBM Corp. 2012.

Download references

Acknowledgements

Not applicable.

Funding

The study was funded by The Scientific and Technological Research Council of Türkiye (TÜBİTAK) (Project No: 121O666).

Author information

Author notes

  1. Dilek Nur Ekinoğlu, Venhar Çelik, Hakan Kalender and Esra Gül are first authors.

Authors and Affiliations

  1. Graduate School of Natural and Applied Sciences, Firat University, Elazığ, Türkiye

    Dilek Nur Ekinoğlu & Esra Gül

  2. Faculty of Engineering, Department of Bioengineering, Firat University, Elazığ, Türkiye

    Venhar Çelik

  3. Faculty of Engineering and Natural Sciences, Department of Bioengineering, Malatya Turgut Özal University, Malatya, Türkiye

    Esra Gül

  4. Faculty of Veterinary Medicine, Department of Microbiology, Firat University, Elazığ, Türkiye

    Hakan Kalender, Hasan Öngör & Burhan Çetinkaya

Authors
  1. Dilek Nur Ekinoğlu
    View author publications

    Search author on:PubMed Google Scholar

  2. Venhar Çelik
    View author publications

    Search author on:PubMed Google Scholar

  3. Esra Gül
    View author publications

    Search author on:PubMed Google Scholar

  4. Hakan Kalender
    View author publications

    Search author on:PubMed Google Scholar

  5. Hasan Öngör
    View author publications

    Search author on:PubMed Google Scholar

  6. Burhan Çetinkaya
    View author publications

    Search author on:PubMed Google Scholar

Contributions

HK and VÇ contributed to the conception, design and writing of the study. DNE, VÇ and EG performed gene cloning and DNA analysis. HK and HÖ carried out recombinant vaccine production and immunization experiments. BÇ conributed interpretation of the data and writing. *: First authors (DNE, VÇ, HK and EG)&: Co-corresponding authors (HK and VÇ).

Corresponding authors

Correspondence to Venhar Çelik or Hakan Kalender.

Ethics declarations

Ethics approval and consent to participate

All experiments were performed in accordance with relevant guidelines and regulations. All methods were reported in accordance with ARRIVE guidelines for the reporting of animal experiments. The approval for the study was obtained from Animal Experiments Local Ethics Committee of Elazığ Veterinary Control Institute (Approval No: 2021/05). The informed consent was obtained from owners of Animals Unit of Elazığ Veterinary Control Institute.

Consent for publication

Not applicable.

Competing interests

The authors declare no competing interests.

Additional information

Publisher’s note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Electronic supplementary material

Below is the link to the electronic supplementary material.

Supplementary Material 1

Rights and permissions

Open Access This article is licensed under a Creative Commons Attribution-NonCommercial-NoDerivatives 4.0 International License, which permits any non-commercial use, sharing, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if you modified the licensed material. You do not have permission under this licence to share adapted material derived from this article or parts of it. The images or other third party material in this article are included in the article’s Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article’s Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit http://creativecommons.org/licenses/by-nc-nd/4.0/.

Reprints and permissions

About this article

Check for updates. Verify currency and authenticity via CrossMark

Cite this article

Ekinoğlu, D.N., Çelik, V., Gül, E. et al. Sheep immune response against a novel recombinant enterotoxemia and infectious necrotic hepatitis vaccine in Türkiye. BMC Vet Res 21, 380 (2025). https://doi.org/10.1186/s12917-025-04841-6

Download citation

  • Received:

  • Accepted:

  • Published:

  • DOI: https://doi.org/10.1186/s12917-025-04841-6

Keywords

BMC Veterinary Research

ISSN: 1746-6148

Contact us