Cloning, expression, purification and characterization of Leishmania tropica PDI-2 protein

Dina Ali; Abdul-Qader Abbady; Mahmoud Kweider; Chadi Soukkarieh

doi:10.1515/biol-2016-0022

Enjoy 40% off

Everything on De Gruyter Brill *

Article Open Access

Cloning, expression, purification and characterization of Leishmania tropica PDI-2 protein

Dina Ali , Abdul-Qader Abbady , Mahmoud Kweider and Chadi Soukkarieh

Published/Copyright: September 2, 2016

Published by

Become an author with De Gruyter Brill

Submit Manuscript Author Information Explore this Subject

From the journal Open Life Sciences Volume 11 Issue 1

Abstract

In Leishmania species, protein disulfide isomerase (PDI) is an essential enzyme that catalyzes thiol-disulfide interchange. The present work describes the isolation, cloning, sequencing and expression of the pdI-2 gene. Initially, the gene was amplified from L. tropica genomic DNA by PCR using specific primers before cloning into the expression vector pET-15b. The construct pET/pdI-2 was transformed into BL21(DE3) cells and induced for the protein expression. SDS-PAGE and western blot analysis showed that the expressed protein is about 51 kDa. Cloned gene sequence analysis revealed that the deduced amino acid sequence showed significant homology with those of several parasites PDIs. Finally, recombinant protein was purified with a metal-chelating affinity column. The putative protein was confirmed as a thiol - disulfide oxidoreductase by detecting its activity in an oxidoreductase assay. Assay result of assay suggested that the PDI-2 protein is required for both oxidation and reduction of disulfide bonds in vitro. Antibodies reactive with this 51 kDa protein were detected by Western blot analysis in sera from human infected with L. tropica. This work describes for the first time the enzymatic activity of recombinant L. tropica PDI-2 protein and suggests a role for this protein as an antigen for the detection of leishmaniasis infection.

Keywords: Protein disulfide isomerase; PCR amplification; cloning; expression; Leishmania tropica

1 Introduction

Leishmaniasis is a major vector-borne metazoonosis disease [1,2] caused by obligate intramacrophage protozoa of the genus Leishmania. Leishmaniasis is still one of the world’s most neglected diseases, affecting largely the poorest of the poor, mainly in developing countries; 350 million people are considered at risk of contracting leishmaniasis, and some 2 million new cases occur yearly in 88 countries [3]. Leishmaniasis can be classified into three general types of disease: cutaneous leishmaniasis (CL), mucosal leishmaniasis (ML), and visceral leishmaniasis (VL), based on the clinical manifestations of the disease [4]. Cutaneous leishmaniasis (CL) caused by L.major, L. aethiopica and L. tropica in the Old World [3]. To date, no effective vaccine is available and treatment by pentavalent antimonial drugs is only occasionally effective and often toxic for patients [5]. Therefore, more efforts to introduce a new protein for vaccine production are currently being considered. Up to date, various antigens such as KMP11, TSA and Gp63 have been evaluated for assess their potential for DNA or recombinant vaccine development against leishmaniasis [6-8]. Leishmania protein disulfide isomerase (PDI) is encoded by a single gene copy which appeared to be structurally conserved among the three Leishmania species, namely, L. major, L. donovani, and L. infantum [9,10]. It is expressed and secreted at both promastigote and amastigote stages of different Leishmania species [9,11]. The PDI, which is a member of the thioredoxin superfamily, is localized in the endoplasmic reticulum (ER) and responsible for introducing disulfide bonds into proteins [12]. During disulfide formation, two cysteines must be correctly aligned and oxidized. PDI is a multi-domain protein with four thioredoxin domains linked in tandem with a C-terminal anionic tail. The two catalytic domains are located in the N- and C-terminal thioredoxin domains, separated by the two noncatalytic thioredoxin domains [13]. The two active sites both contain a CGHC sequence in which the cysteine near theN-terminus is exposed and able to react with substrate cysteines [14]. The PDI protein in pathogens that are important for human infections [15]. Four L. amazonensis PDIs encoding 52-, 47-, 40-, and 15 kDa proteins have been characterized. Homology analysis showed that the sequence identity between L. amazonensis (New World) PDIs and their counterpart PDI sequences from L. major (Old World) ranged from 76% to 99% [16]. Meek et al 2002 have detected IgG specific to four LaPDIs (especially to the 52 kDa PDI, known as PDI-2) [17]. Further, Ben Achour et al. 2002 reported that the 52 kDa LmPDI is linked to L. major virulence and in addition to its sequence homology with the members of PDI family, LmPDI expressed a specific enzymatic activity [9]. Previous results showed that PDI-2 was identified as one of the soluble leishmanial protein that induced a Th1 response in the PBMCs of Leishmania infected cured/endemic patients [18]. Further, rLdPDI-2 has been identified as a Th1 stimulatory and supposed to be the effector molecules for defense mechanism against Leishmania infection [19]. In this report, we described the isolation, cloning, sequencing, expression and characterization of the putative PDI-2 protein of L. tropica. As well, recombinant PDI-2 has been utilized as an antigen for the detection of leishmaniasis infection.

2 Material and Methods

2.1 Bacterial strains and plasmids

E. coli DH10B (Gibco BRL) and E. coli BL21 (DE3) (Novagen) were used as the host strains for cloning and expression of pdI-2 gene, respectively. Plasmid used in this study was the pET-15b (Novagen, USA) for cloning and expression of pdI-2 gene. E. coli strain transformants were grown at 37°C in Luria–Bertani (LB) (10 g of Tryptone, 5 g of Yeast Extracts, 10 g of NaCl) that contained 100 μg of ampicillin per ml for selection of clones containing pET-15b.

2.2 Parasites growth conditions

L. tropica (Skin Hospital in Damascus, Syria) was used as the parental strain for extraction of genomic DNA. Promastigotes were cultured in a RPMI1640 medium (Sigma, Germany) supplemented with 10% heat-inactivated fetal bovine serum (FBS), 100 U/ ml L-Glutamine and 100 U/ ml penicillin-streptomycin (Cytogen, Germany). This culture was then incubated at 26°C.

2.3 Cloning of L. tropica pdI-2 gene

The DNA of L. tropica was extracted using Wizard genomic DNA purification kit (Promega). The pdI-2 gene was isolated and amplified from L. tropica DNA by PCR using specific primers: the forward primer (5`ATATATCATATGCCTGTAGCGCTTAATCG3`) containing a NdeI restriction site and the reverse primer (5`ATATATGGATCCTCAAAGAGCGCTGTCGAT3`) containing a BamHI restriction site. These primers were designed according to pdI-2 gene sequence of L. major (Genebank Accession No. FR796432). The PCR reaction mixture contained 300 ng of DNA template, 200 μM of dNTPs, 0.5 μM of each primer, 1× reaction buffer and 1U of high fidelity DNA polymerase (Phusion, England Biolabs) in a final volume of 50 μl. The PCR cycling was performed under the following conditions: 30 sec at 98°C, 30 times (10 sec at 98°C; 30 sec at 53°C of appropriate primers; 30 sec at 72°C) and 10 min at 72°C. Finally, the PCR product was analyzed by electrophoresis on a 0.8% agarose gel. The plasmid, pET-15b and the PCR product were then cut with the restriction enzymes NdeI and BamHI (Fermentase). Each of the restriction enzyme digest products, pET-15b and pdI-2, were separated by electrophoresis on a 0.8% agarose gel at 80 V. Linearized DNA of the cloning vector pET-15b and the pdI-2 amplicon were extracted from the agarose gels using the QIAquick Gel Extraction Kit (Qiagen) and then ligated using ligase T4 enzyme (Fermentase) to produce the pET/pdI-2 construct. The ligation mixture was incubated overnight at 16°C, then the recombinant plasmid pET/pdI-2 was transformed into E. coli DH10B. At the same time, the pET-15b plasmid was transformed and used as a positive control.

2.4 DNA Sequencing

DNA sequencing for pET/pdI-2 plasmid was performed on a Genetic 114 Analyzer system ABI-310 using universal specific primers for the pdI-2 to verify that the pdI-2 gene was indeed cloned into the pET-15b vector. Homology searches were performed using the BLAST program (http://www.ncbi.nlm.nih.gov/BLAST).

2.5 Protein overexpression and purification

The recombinant expression plasmid pET/pdI-2 was transformed into E. coli BL21 (DE3) cells for protein expression. Freshly transformed cells were plated onto solid LB/Amp. One positive transformant harboring the pET/pdI-2 construct was chosen randomly and grown at 37°C in 1 liter of LB. IPTG (Isopropyl β-D-thiogalactoside; Promega) was added to the culture, OD₆₀₀ of 0.5 - 0.7, at a final concentration of 0.5 mM. After 16 h of induction at 18°C, bacterial cells were harvested by centrifugation at 6000 rpm for 30 min at 4°C, then the harvested cells were responded in lysis buffer (20 mM Na₂HPO₄ · 7H₂O, 0.5 M NaCl, 20 mM NaH₂PO₄ · 2H₂O, 20 mM imidazole). The lysate was added to the frenchpress (Constant systems) and pressure applied (Total processing time, 10 min; 1 Kbr), then the disrupted extract was centrifuged at 12000 rpm for 20 min at 4°C and the supernatant collected as a soluble extract. The pellet was then resuspended in protein-extraction lysis buffer (20 mM Na₂HPO₄ · 7H₂O, 0.5 M NaCl, 20 mM NaH₂PO₄ · 2H₂O, 20 mM imidazole, 6 M urea) and incubated for one hour on ice then centrifuged at 12000 rpm for 20 min at 4°C and the supernatant collected as an insoluble extract. The supernatant containing PDI-2 was then purified by affinity chromatography using nickel-charged column installed on AKTAexplorer system at a flow rate of 1.0 ml/min. The purity of the PDI-2 was confirmed by SDS-PAGE stained with Coomassie Blue reagent (Sigma; Germany). The pooled fractions from the PDI-2 purification were added to (PD10) dialysis tubing (GE Healthcare, USA) and exchanged into 4 L PBS 1× at pH 7.4. The purified protein was used for further characterization. Protein concentration was determined colorimetrically using a Bio-Rad protein assay kit using a bovine serum albumin (BSA) as a standard.

2.6 SDS-PAGE analysis and Western blot

Sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) was carried out using a Bio-Rad mini-Protein II system following the manufacturer’s instructions. Gels were prepared using stacking gel 4% and running gel 12%. Gels were run for one hour at 120 volts, and either Coomassie-stained or Western blotted. Gels for western blot analysis were transferred to 0.45 μm nitro-cellulose membranes (BDH, Electran). The membranes were blocked for overnight in PBS 1× containing 5% skim milk and 0.05% Tween 20. Then the blots were incubated with mouse anti- 6×His antibody (1:2000; RD biosystems). The membrane was washed three times with PBS 1× supplemented with 0.05% Tween 20 and then incubated with goat anti-mouse secondary antibody conjugated to horseradish peroxidase (HRP) (Bethyl laboratories) at a dilution of 1:3000 for 1 h, and detected by AEC (3-amino-9- ethylcarbazole) chromagen substrate in phosphate citrate buffer in the presence of hydrogen peroxide. Alternatively, blots were incubated with 1/1000 dilution of sera from CL patients, then incubated with 1/5000 dilution of goat antihuman antibody conjugated to HRP (Thermo) and then revealed as described previously.

2.7 Assay for redox activity of PDI-2

In vitro disulfide reductase activity of PDI-2 was measured by the ability of the protein to catalyze the reduction of insulin by DTT [20]. The reaction mixtures were prepared fresh in 1 ml cuvettes by adding final concentrations of 0.13 mM insulin (Sigma), 0.33 mM DTT, 0.1 M sodium phosphate, 2 mM EDTA, pH 7 to two concentrations of the protein (1.5 and 4 μM). After thorough mixing, the reduction of insulin was monitored by measuring the optical density of the samples at 650 nm for 70 min at 60 s intervals. The non-catalysed reduction of insulin by DTT was monitored in a control reaction without catalyst. Data were expressed as the mean value ± standard deviation of three independent experiments.

2.8 Assay of Oxidative Folding of Reduced RNase A

Assay of oxidative folding of reduced RNase A was performed as follows: reduced RNase A (final concentration 0.2 mg/ml) was incubated in 0.6 mM DTT, 0.2 mM GSSG, 1 mM MgC1₂, 45 mM Tris acetate, pH 8.0, in the presence or absence of 0.55 mg/ml purified PDI-2. Eighty-microliter portions were withdrawn from the reaction solution at appropriate intervals and were mixed with 1.12 ml of cyclic 2’,3’-CMP (0.1 mg/ml) in 100 mM sodium phosphate, 1 mM EDTA pH 7, and incubated at 25°C for 3 min. Hydrolysis of cyclic 2’,3’-CMP was measured by the increase of absorption at 296 nm [21]. Data were expressed as the mean value ± S.D. calculated from three independent experiments.

2.9 Disulfide isomerase assay (scrambled RNase A assay)

Activity of PDI was assayed by a method based on the catalysis of the oxidative refolding of “scrambled” bovine pancreatic RNase type III-A as described by Lyles and Gilbert [22]. In brief, 8 μM reduced and denatured RNase A (Sigma; Germany) was incubated with 0.55 mg/ml purified recombinant PDI-2 protein in a buffer containing 4.5 mM cyclic-2′,3′-cytidinemonophosphate (cCMP) (Sigma), 1mM reduced glutathione (Sigma), 0.2 mM oxidized glutathione (Sigma), 2 mM EDTA, and 100 mM Tris-HCl (pH 8). RNase activity was assayed by monitoring the rate of change of absorbance at 296 nm at 25°C during 60 min. Data were expressed as the mean value ± S.D. of three independent experiments.

3 Results

3.1 Isolating and cloning of pdI-2 gene

Because the genome sequencing of L. tropica was incomplete, sequence pdI-2 from L. major was used to design pairs of universal primers for the amplification of L. tropica pdI-2 gene. Using extracted genomic DNA as a template, the coding sequence of the pdI-2 gene was amplified by PCR, resulting in a DNA fragment with NdeI and BamHI sites at the 5 and 3 end, respectively (Fig. 1A). The size of the PCR product was about, 1434 bp, verified by 0.8% agarose gel electrophoresis. The approximately 1434 bp of pdI-2 amplicon is in accordance with the theoretical length of the open reading frame (ORF) deposited in the GenBank of Leishmania (Genebank Accession No. FR796432), indicating that a fragment of a gene encoding a PDI-2 protein had been amplified. NdeI and BamHI digested, pdI-2 and pET-15b, were purified and used in a ligation reaction in an appropriate molar ratio of 1:10 (vector:insert). The transformation was then performed in E. coli DH10B cells. Twelve random transformants were verified by colony PCR using pdI-2 specific primers. According to the colony PCR result, eleven colonies were positive (Fig. 1B). Then a miniprep was carried out on two of these colonies and digested with NdeI and BamHI enzymes to confirm the presence of pdI-2 insert (Fig. 1C). Double digestion of pET/pdI-2 with the enzymes (NdeI/BamHI) resulted in the plasmid pET (5696 bp) and also the inserted pdI-2 gene (1434 bp), comparing with the resulted fragment (5696 bp) of the linearized empty pET (Fig. 1C).

Fig. 1

Cloning of pdI-2 gene into pET-15b plasmid. DNA fragments from the different steps of the cloning were separated into 0.8% agarose gel. (A). Amplification of pdI-2 gene; Lane 1- DNA ladder molecular marker; lane 2- pdI-2 PCR product; lane 3- negative control, no DNA template added. (B) Result of colony PCR screening performed on 12 randomly selected clones after transformation with the ligation reaction product. Lane 1- DNA ladder molecular marker; lanes 2, 4, 5, 6, 7, 8, 9, 10, and 11-positive clones contain full-length pdI-2 gene (1434 bp); lane: 12, negative colony that doesn’t contain the pdI-2 gene. (C) Identification of recombinant pET/pdI-2 plasmid by restriction enzyme digestion; Lane 1- DNA molecular marker; lanes 2, and 3- the pET/pdI-2 construct, respectively, was isolated from their transformed colonies by miniprep and then digested with NdeI and BamHI enzymes; lane 4- NdeI and BamHI restriction endonuclease digest of pET-15b; Lane 5- plasmid pET-15b without digestion.

3.2 Sequence analysis of the pdI-2 gene

The 1434 bp gene encoded 477 amino acids with a predicted molecular mass of 52.38 kDa. The cloned sequence analysis revealed that no mutations were introduced during the cloning process and pET/pdI-2 construct was accurate. The result of the alignment of the pdI-2 gene sequences is shown in a dendrogram (Fig. 2) and the resulting sequence was sent for registration in NCBI database (GenBank accession number: KU500810). The sequence of pdI-2 gene was compared with those of other Leishmania species using BLAST program against NCBI, and the overall similarities were found to be relatively high (83–100%). Of note, while the pdI-2 gene was highly similar (100%) with L. major, and (94%) with both L. infantum and L. donovani, it showed 91 % homology in both L. mexicana and L. amazonensis. However, it was 83% homologue with L. braziliensis, a result which reflects the fact that pdI-2 gene seems to be highly conserved in leishmania genus. A comparison of the predicted amino acid sequence of PDI-2 with that of many PDIs revealed a striking sequence similarity (64% amino acid sequence identity with Leptomonas seymouri PDI) (Fig. 3). The deduced amino acid sequence of PDI-2 showed significant homology with those of several different organisms PDIs bearing the Cys-X-X-Cys motif, for example, 37% homology with Trypanosoma brucei PDI, and 29% with the of Plasmodium falciparum PDI (Fig. 3).

Fig. 2

Dendrogram of pdI-2 gene sequences from different Leishmania species that were aligned with the local L. tropica pdI-2 gene.

Fig. 3

Comparison of the deduced amino acid sequence of PDI-2 with those of other disulfide oxidoreductases. PDI-2 residues are aligned with the region surrounding the catalytic site of Leptomonas seymouri PDI, Trypanosoma brucei PDI, and Plasmodium falciparum PDI. In each sequence, catalytic amino acid domains are marked with light gray, and analogous amino acids are marked with asterisks.

3.3 Expression and purification of PDI-2

The E. coli BL21 (DE3) strain, transformed with the recombinant expression plasmid pET/pdI-2, was induced with 0.5 mM IPTG and grown for 16 h at 18°C, resulting in the accumulation of high amounts of a PDI-2 protein of about 51 kDa, (Fig. 4A). The overexpressed protein is not detected in the un induced bacteria (Fig. 4A). This 51 kDa molecular weight was slightly different from the expected PDI-2 molecular weight of 52.38 kDa, which was calculated according to the protein molecular weight using the website (http://www.bioinformatics.org/sms/prot_mw.html). These bands correspond to the expressed PDI-2 as confirmed by western blot using anti-6×His conjugated antibody (Fig. 4B). The expressed PDI-2 was found in the soluble bacterial extract (supernatant), but not in the solubilized pellet (Fig. 5B, lane 3), suggesting that the recombinant protein was being expressed by the soluble form (Fig. 5B, lane 2). Purification of the PDI-2 from the soluble extract was then done by metal affinity chromatography, using a nickel charged column installed on an AKTAexplorer system. The UV- detector, supplemented with this system, enabled the real-time monitoring of the different steps of PDI-2 purification (Fig. 5A). The purified protein migrated with molecular weight of approximately 51 kDa as detected with coomassie brilliant blue staining (Figure. 5B, lane 4). The yield of purified recombinant protein reached ~600 mg/L of bacteria culture. Moreover, in immunoblotting, the antibodies reactive with the ~51 kDa purified PDI-2 protein were detected in sera from a human infected with L. tropica (Fig. 5C). Thus, the PDI-2 appears to be immunogenic in human.

Fig. 4

SDS-PAGE and Western blot analysis of the expression of PDI-2. Proteins were separated on 12% SDS-PAGE gel and visualized by Coomassie staining or Western blotted using mouse anti-6×His conjugated antibody (1/2000). (A) Lane 1- Molecular mass standard; Lane 2 - E. coli BL21 (DE3) carrying pET/pdI-2 before induction; lane 3- E. coli BL21(DE3) carrying pET/pdI-2 after 16 h of IPTG induction at 18°C, the expressed PDI-2 protein is indicated by a blue box. (B) Lane 1- molecular size marker (in kDa); Lanes 2 and 3- E. coli BL21 (DE3) carrying pET/pdI-2 before and after induction, respectively.

Fig. 5

Protein migration in SDS-PAGE (acrylamide 12%) of protein samples obtained after different steps of purification. (A) Diagram of purification procedure using nickel charged column installed on FPLC AKTA explorer system. Continuous line represents the absorbance of the eluate, peaks of the flow through sample and of purified PDI-2 are indicated. (B) SDS–PAGE analysis of the extraction and purification of PDI-2 protein. Lane 1- Molecular mass standard (in kDa); Lane 2- soluble bacterial extract; lane 3- insoluble bacterial extract; lane 4- purified PDI-2 protein. (C) Reaction of purified recombinant PDI-2 protein in Western blot with sera from patients infected with Leishmania: Lane- 1 Molecular mass standard (in kDa); Lanes: 2, 3, and 4- sera from human infected with Leishmania; Lane: 5, negative serum (The negative control was taken from individual never infected by Leishmania).

3.4 Insulin reduction assay

Insulin contains two polypeptide chains, A and B, that are linked by two interchain disulfide bonds. When these bonds are broken, a white precipitate forms mainly from the free B chain of insulin which is insoluble. The purified PDI-2 protein was incubated with insulin and found to stimulate insulin precipitation (Fig. 6A). In the control cuvette, containing only dithiothreitol, no precipitation was observed until after 36 min. The addition of 4 μM PDI-2 resulted in rapid precipitation appearing after 17 min, demonstrating a catalytic effect of PDI-2 (Fig. 6B), Whereas a lower concentration of PDI-2, 1.5 μM resulted in a longer delay before turbidity appeared and a corresponding slower rate of precipitation (Fig. 6B). Thus, PDI-2 catalyzed the dithiothreitol reduction of insulin disulfides.

Fig. 6

Insulin reduction assay. (A) Scheme of the reduction reaction catalyzed by PDI-2 (B) PDI-2-catalyzed reduction of insulin by dithiothreitol. Reactions were performed in a final volume of 1 mL containing 0.1 M sodium phosphate (pH 7.0), 2 mM EDTA, 0.13 mM bovine insulin, 0.33 mM dithiothreitol, and purified PDI-2 protein (●). Only dithiothreitol without PDI-2 served as control (○). The reduction of insulin and its resulting precipitation were monitored by following optical density at 650 nm for 70 min at 60 s intervals.

3.5 PDI-2-stimulated Oxidation and Disulfide Bond Isomerization of RNase A

The RNase A was used as a substrate to study in vitro both oxidation and isomerization activities of the PDI-2 protein. RNase A is a single chain polypeptide containing four disulfide bridges, and when these native disulfide bridges are formed, RNase A can cleave cyclic-2′,3′-cytidinemonophosphate (cCMP) into 3′-cytidinemonophosphate (3′CMP), resulting in an increase in absorption at 296 nm (Fig. 7A). Initially, the ability of PDI-2 to stimulate oxidative refolding of reduced, denatured RNase A was examined. When Reduced, denatured RNase was incubated in the presence of PDI-2, GSSG, and DTT for 60 min, about 50% of RNase activity was regained, whereas only 26% was regained in the absence of PDI-2 (Fig. 7B). Furthermore, the ability of PDI-2 to catalyze exchange of preformed disulfide bonds was examined (Fig. 8A). An RNase A preparation with scrambled disulfide bridges was incubated with PDI-2 in the presence of redox buffer (GSH/GSSG) (Fig. 8B), and restored 30 % RNase activity within 60 min. By contrast, the recovery of RNase activity was significantly lower in the absence of PDI-2, with exactly 15% of native activity restored within 60 min. The redox conditions used for the oxidative folding (DTT and GSSG) resulted in no PDI-2-stimulated activation of the scrambled RNase A. These results suggest that the PDI-2 protein isolated from L. tropica is active in vitro in both oxidization and disulfide bond interchange reactions.

Fig. 7

PDI-2-stimulated oxidation of RNase A. (A) Scheme of the oxidative folding reaction catalyzed by PDI-2. (B) Reduced RNase A prepared as described under “Experimental Procedures” was incubated with (●) or without (○) 0.55 μg/μl PDI-2 in the presence of 0.2 mM GSSG and 0.6 mM DTT. Samples were withdrawn at intervals and assayed for RNase activity relative to an equivalent amount of native RNase.

Fig. 8

PDI-2-stimulated disulfide interchange of scrambled RNase A. (A) Scheme of the isomerization reaction catalyzed by PDI-2. (B) Scrambled RNase A was incubated with 0.2 mM GSSG plus 0.6 mM DTT with (●) or without (Δ) 0.55 μg/μl PDI-2, or with 0.2 mM GSSG plus 1 mM GSH. 0.55 μg/μl PDI-2 ($#x25B4;).

4 Discussion

Protein disulfide isomerase (PDI) is a multifunctional protein of the thioredoxin superfamily. PDI mediates proper protein folding by oxidation or isomerization and disrupts disulfide bonds by reduction; it also has chaperone activity [14]. In this paper, we reported for the first time the cloning and expression of the L. tropicapdI-2 gene using pET-15b plasmid. The results indicate that pdI-2 gene amplified by PCR, is highly homologous to the theoretical length of the ORF deposited in the Genbank (Genebank Accession No. FR796432). PDI-2 is encoded by a single gene copy which appeared to be structurally conserved among the three Leishmania species tested so far, namely, L. major, L. donovani, and L. infantum [9]. The size of pdI-2 gene product was about, 1434 bp in all the species. Furthermore, the pdI-2 gene was successfully cloned into the pET-15b expression vector and expressed in E. coli BL21 (DE3). The overexpressed PDI-2 was then purified by nickel chelate chromatography and confirmed by SDS-PAGE with an apparent molecular weight of about 51 kDa. The recombinant PDI-2 protein presents a possible applicable approach for CL serological diagnosis, since this protein gave a positive result in immunoblotting using many different sera from CL patients. Furthermore, recombinant PDI-2 may be able to detect CL disease which is caused by different Leishmania species, since PDI-2 is a conserved antigen between different Leishmania species [9, 10]. In addition, recombinant PDI-2 presents a possible tool for developing one of CL candidate vaccine, and more steps can be achieved for production and testing of PDI-2 as a recombinant protein vaccine. Recent studies have obviously characterized L. donovani PDIs as important protein for the design of new drug or vaccine against Leishmania parasites. In this species two groups have reported a 15 kDa atypical PDI with only one catalysing site “CGHC” [23] and a 55 kDa PDI [19]. Amit et al. 2014 showed that protein of 15 kDa PDI promoted L. donovani infection, rendering macrophages more toxic which up regulates immunosuppressive factors such as IL-10 and causes retardation of anti-Leishmania activity of macrophage. Moreover, this study also showed that replacing two of the cysteines of PDI with alanine in its active site served as inhibitor of PDI activity and grossly attenuated disease progression [24]. However, Joshi et al 2016 reported that ~55 kDa PDI exhibited good T-cell reactivity in PBMCs of treated VL patients and generated Th1 type immune response which was characterized by high production of Th1 type cytokines: IFN-γ, IL-12 and TNF-α that are associated with Leishmania killing [25].

We then investigated the oxidoreductase activity of PDI-2 using the purified recombinant protein. We showed that PDI-2 exhibits oxidoreductase activity in the insulin reductase activity. The PDI-2 (4 μM) rapidly reduces the disulfide bonds of insulin; disulfide reduction is detectable within 17 min. Moreover, the oxidase activity of the PDI-2 were determined using RNase A as a substrate. In this assay, we have shown that PDI-2 is able to stimulate the refolding of reduced, denatured bovine RNase A, which contains four disulfide bonds, and therefore conclude that PDI-2 can intermediate in the refolding of many proteins, containing more than two cysteine residues. In addition, PDI enzymes also have the ability to refold RNase-A that has been reduced, denatured, and randomly refolded by reoxidation in air (‘scrambled’). This assay has been used as a common measure of protein-disulfide isomerization by using the proper redox buffer (GSH/GSSG) [26]. In this assay, LtPDI-His showed significant activity in refolding the scrambled RNase A. The proposed mechanism of PDI-2-catalyzed folding involves mixed PDI-2-protein disulfide intermediates, as well as thiol-disulfide interchange reactions with GSH/GSSG of both the folding polypeptide and PDI-2. However, PDI-2-mediated disulfide interchange was not detected under the buffer condition used for the oxidative folding of reduced, denatured RNase A, suggesting that interchange reactions could be disregarded in these reactions. Taken together, these results demonstrate that the recombinant LtPDI-His is able to catalyze both oxidation and isomerization of protein disulfides. In a previous another study, Hong and Soong 2008 showed that the L. amazonensis 15, 40, and 47 kDa PDIs display both isomerase and reductase activities. Surprisingly, despite a high degree of homology with Lm PDI (86% of identities and 96% of similarities), the 52 kDa L. amazonensis PDI protein displayed only the isomerase activity [16]. In the another study that was done by Padilla et al., 2003, the PDI-2 from L. donovani also displays both the oxidase and isomerase activities [23]. More recently, several studies indicated a role for disulfide bond A (DsbA), a bacterial homologue of PDI, in the pathogenicity of some microorganisms [27, 28]. Moreover, DsbA is involved in the biogenesis of the enterotoxin and the toxin-coregulated pili of Vibrio cholerae [29]. DsbA is also important for pathogenic E. coli [30]. These data suggest that, by analogy with Dsb proteins, parasite PDIs could be indirectly involved in parasite pathogenicity by catalyzing the optimal folding of virulence factors secreted from the membrane surface or in the extracellular environment. Therefore, parasite PDIs may constitute potential drug targets.

5 Conclusion

This work describes the first functional characterization of a L. tropica putative PDI-2 protein, overexpressed and purified from E. coli BL21 (DE3). The methodology to produce purified PDI-2 now enables structural studies as well as further functional analyses to help elucidate the role of this protein in the folding and secretion of virulence proteins involved in the Leishmania pathogen, as well as study of its role in inducing a protective immune against Leishmania infection in order to develop better vaccines against Old World cutaneous Leishmaniasis.

Conflict of interest: Authors declare nothing to disclose.

Acknowledgements

The authors would like to thank Damascus University for the continuous support throughout this work; Dermatology Hospital in Damascus for permission to obtain leishmania specimens from CL patients.

References

[1] Assimina Z., Charilaos K., Fotoula B., Leishmaniasis: an overlooked public health concern, Health Sci. J, 2008, 2, 196-205.Search in Google Scholar

[2] Pal M., Zoonoses, RM publisher and distributor, New Delhi, India, 2007.Search in Google Scholar

[3] WHO, Control of the leishmaniases. Report of a meeting of the WHO Expert Committee on the Control of Leishmaniases, 2010, 22–26 March, Geneva 5-88.Search in Google Scholar

[4] Handman E., Cell biology of Leishmania, Adv. Parasitol., 1999, 44, 1–39.10.1016/S0065-308X(08)60229-8Search in Google Scholar

[5] Sundar S., More D.K., Singh M.K,, Singh V.P., Sharma S., Makharia A, Kumar P.C.K., Murray H.W., Failure of pentavalent antimony in visceral leishmaniasis in India: report from the center of the Indian epidemic, Clin. Infect. Dis., 2000, 31(4), 1104-7.10.1086/318121Search in Google Scholar PubMed

[6] Guha R., Das S., Ghosh J., Naskar K, Mandala A., Sundar S., Dujardin J.C, Roy S., Heterologous priming-boosting with DNA and vaccinia virus expressing kinetoplastid membrane protein-11 induces potent cellular immune response and confers protection against infection with antimony resistant and sensitive strains of Leishmania (Leishmania) donovani. Vaccine, 2013, 31, 1905–1915.10.1016/j.vaccine.2013.02.025Search in Google Scholar PubMed

[7] Nagill R., Kaur S., Vaccine candidates for leishmaniasis: a review, Int. Immunopharmacol., 2011, 11 (10), 1464-88.10.1016/j.intimp.2011.05.008Search in Google Scholar PubMed

[8] Rezvan H., Rees R., Ali S.A., Leishmania mexicana Gp63 cDNA Using Gene Gun Induced Higher Immunity to L. mexicana Infection Compared to Soluble Leishmania Antigen in BALB/C Enhancement of cellular and antibody immune response to Leishmania major, Iranian J. Parasitol., 2011, (6) 4, 60-75.Search in Google Scholar

[9] Ben Achour Y., Chenik M., Louzir H., Dellagi K., Identification of a disulfide isomerase protein of Leishmania major as a putative virulence factor, Infect. Immun., 2002, 70(7), 3576–3585.10.1128/IAI.70.7.3576-3585.2002Search in Google Scholar PubMed PubMed Central

[10] Ben Khalaf N., De Muylder G., Louzir H., McKerrow J., Chenik M., Leishmania major protein disulfide isomerase as a drug target, Parasitol. Res., 2012, 110, 1911–1917.10.1007/s00436-011-2717-5Search in Google Scholar PubMed

[11] Paape D., Barrios-Llerena M.E., Le Bihan T., Mackay L., Aebischer T., Gel free analysis of the proteome of intracellular Leishmania Mexicana, Mol. Biochem. Parasitol., 2010, 169(2), 108–114.10.1016/j.molbiopara.2009.10.009Search in Google Scholar PubMed

[12] Noiva R., Protein disulfide isomerase: the multifunctional redox chaperone of the endoplasmic reticulum, Semin. Cell Dev. Biol., 1999, 10, 481 493.10.1006/scdb.1999.0319Search in Google Scholar PubMed

[13] Kozlov G., Maattanen P., Thomas D.Y., Gehring K., Astructural over view of the PDI family of proteins, FEBS J., 2010, (277), 3924–3936.10.1111/j.1742-4658.2010.07793.xSearch in Google Scholar PubMed

[14] Ferrari D.M., Soling H.D., The protein disulphide-isomerase family: unravelling a string of folds, Biochem. J., 1999, 339 (1),1–10. 1–10.10.1042/bj3390001Search in Google Scholar

[15] Chenik M., Lakhal S., Ben Khalef N., Zribi L., Louzir H., Dellagi K., Approaches for the identification of potential excreted/ secreted proteins of Leishmania major parasites, Parasitology., 2006, 132 (4).10.1017/S0031182005009546Search in Google Scholar

[16] Hong B.X., Soong L., Identification and enzymatic activities of four protein disulfide isomerase (PDI) isoforms of Leishmania amazonensis, Parasitol. Res., 2008, 102 (3), 437–446.10.1007/s00436-007-0784-4Search in Google Scholar

[17] Meek B., Back J.W., Klaren V.N., Speijer D., Peek R. Protein disulfide isomerase of Toxoplasma gondii is targeted by mucosal IgA antibodies in humans, FEBS Lett., 2002, 522 (1-3), 104-108.10.1016/S0014-5793(02)02911-3Search in Google Scholar

[18] Gupta S.K., Sisodia B.S., Sinha S., Hajela K., Naik S., Shasany A.K., Dube A., Proteomic approach for identification and characterization of novel immunostimulatory proteins from soluble antigens of Leishmania donovani promastigotes, Proteomics, 2007, 7 (5), 816-823.10.1002/pmic.200600725Search in Google Scholar

[19] Kushawaha P.K., Gupta S.K., Tripathi C.D.P., Sundar S., Dube A., Evaluation of Leishmania donovani Protein disulfide isomerase as a potential immunogenic protein/vaccine candidate against visceral leishmaniasis, PLoS One, 2012, 7 (4), 35670.10.1371/journal.pone.0035670Search in Google Scholar

[20] Holmgren A., Thioredoxin catalyzes the reduction of insulin disulfides by dithiothreitol and dihydrolipoamide, J. Biol. Chem., 1979, (254), 9627–9632.10.1016/S0021-9258(19)83562-7Search in Google Scholar

[21] Blackburn P., Ribonuclease Inhibitor from Human Placenta: Rapid Purification and assay, J. Biol. Chem., 1979, 264, 12484-1248710.1016/S0021-9258(19)86340-8Search in Google Scholar

[22] Lyles M.M., Gilbert H.F., Catalysis of the oxidative folding of ribonuclease A by protein disulfide isomerase: pre-steady-state kinetics and the utilization of the oxidizing equivalents of the isomerase. Biochemistry, 1991, 30, 619–625.10.1021/bi00217a005Search in Google Scholar PubMed

[23] Padilla A., Noiva R., Lee N., Mohan K.V., Nakhasi H.L., Debrabant A., An atypical protein disulfide isomerase from the protozoan parasite Leishmania containing a single thioredoxinlike domain, J. Biol. Chem., 2003, 278(3), 1872–1878.10.1074/jbc.M210322200Search in Google Scholar PubMed

[24] Amit A., Chaudhary R., Yadav A., Suman S.S., Narayan S., Das V.N.R., Pandey K., Singh S.K., Singh B.K., Ali V., Das P., Bimal S., Evaluation of Leishmania donovani disulfide isomerase as a potential target of cellular immunity against visceral leishmaniasis, Cell. Immunol., 2014, (289), 76–85.10.1016/j.cellimm.2014.03.011Search in Google Scholar PubMed

[25] Joshi S., Yadav N.K., Rawat K., Tripathi C.D.P., Jaiswal A.K., Khare P., Tandon R., Baharia R.K., Gupta S.D.R., Kushawaha P.K., Sundar S., Sahasrabuddhe A. A., Dube A., Comparative Analysis of Cellular Immune Responses in Treated Leishmania Patients and Hamsters against Recombinant Th1 Stimulatory Proteins of Leishmania donovani, Front. Microbiol., 2016, (7), 1-8.10.3389/fmicb.2016.00312Search in Google Scholar

[26] Hawkins H.C., Blackburn E.C., Freedman R.B., Comparison of the activities of protein disulphide-isomerase and thioredoxin in catalysing disulphide isomerization in a protein substrate, Biochem. J., 1991, (15) 275, 349–353.10.1042/bj2750349Search in Google Scholar

[27] Bardwell J.C., Building bridges: disulphide bond formation in the cell, Mol. Microbiol., 1994, 14, 199–205.10.1111/j.1365-2958.1994.tb01281.xSearch in Google Scholar

[28] Yu, J., Kroll, J. S., DsbA: a protein-folding catalyst contributing to bacterial virulence. Microbes Infect., 1999, (1), 1221–1228.10.1016/S1286-4579(99)00239-7Search in Google Scholar

[29] Peek J.A., Taylor R.K., Characterization of a periplasmic thiol: disulfide interchange protein required for the functional maturation of secreted virulence factors of Vibrio cholere, Proc. Natl. Acad. Sci. USA, 1992, 89, 6210–6214.10.1073/pnas.89.13.6210Search in Google Scholar PubMed PubMed Central

[30] Wang Y., Bjes E.S., Esser A.F., Molecular aspects of complement-mediated bacterial killing. Periplasmic conversion of C9 from a protoxin to a toxin, J. Biol. Chem., 2000, (275), 4687–4692.10.1074/jbc.275.7.4687Search in Google Scholar PubMed

Received: 2016-4-4

Accepted: 2016-7-14

Published Online: 2016-9-2

Published in Print: 2016-1-1

This work is licensed under the Creative Commons Attribution-NonCommercial-NoDerivatives 3.0 License.