Next Article in Journal
Analysis of Causative Factors and Potential Predictors of Onychomycosis: A Retrospective Single-Center Study in Poland
Next Article in Special Issue
What Are “Lingzhi Wang” or “Zhu Lingzhi”? Notes on Ganoderma (Ganodermataceae, Polyporales) Species Characterized by Diminutive Pilei and Gracile Stipes from Hainan Island, Tropical China
Previous Article in Journal
Evaluation of the Effects of Epicoccum nigrum on the Olive Fungal Pathogens Verticillium dahliae and Colletotrichum acutatum by 1H NMR-Based Metabolic Profiling
Previous Article in Special Issue
Diversity and Multigene Phylogeny of the Genus Floccularia (Agaricales, Basidiomycota)
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
JoF
Volume 11
Issue 2
10.3390/jof11020130
jof-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

The Mechanism of Ammonia-Assimilating Bacteria Promoting the Growth of Oyster Mushrooms (Pleurotus ostreatus)

by
Rui Li
1,
Qi Zhang
1,
Yuannan Chen
1,
Yuqian Gao
1,*,
Yanqing Yang
1,
Qin Liu
2,
Weili Kong
2,*,
Haopeng Chai
1,
Bingke Sun
1,
Yanan Li
1 and
Liyou Qiu
1,*
1
Key Laboratory of Enzyme Engineering of Agricultural Microbiology, Ministry of Agriculture and Rural Affairs, College of Life Sciences, Henan Agricultural University, Zhengzhou 450046, China
2
Key Laboratory of Evaluation and Utilization of Germplasm Resources of Edible Fungi in Huang-Huai-Hai Region, Institute of Edible Fungi, Henan Academy of Agricultural Sciences, Ministry of Agriculture and Rural Affairs, Zhengzhou 450002, China
*
Authors to whom correspondence should be addressed.
J. Fungi 2025, 11(2), 130; https://doi.org/10.3390/jof11020130
Submission received: 25 January 2025 / Revised: 6 February 2025 / Accepted: 8 February 2025 / Published: 9 February 2025
(This article belongs to the Special Issue Edible and Medicinal Macrofungi, 3rd Edition)
Browse Figures
Versions Notes

Abstract

:
Oyster mushrooms (Pleurotus ostreatus) are one of the most commonly grown edible mushrooms using compost, which contains high concentrations of ammonia. In this study, inoculation of the oyster mushroom culture substrate with ammonia-assimilating bacterium Enterobacter sp. B12, either before or after composting, reduced the ammonia nitrogen content, increased the total nitrogen content of the compost, and enhanced the mushroom yield. Co-cultivation with P. ostreatus mycelia on potato dextrose agar (PDA) plates containing 200 mM NH4+, B12 reduced reactive oxygen species (ROS) accumulation in the mycelia and downregulated the expression of the ROS-generating enzymes NADPH oxidase A (NOXA) and the stress hormone ethylene synthase 1-aminocyclopropane-1-carboxylate oxidase (ACO). It also downregulated the expression of the ammonia-assimilating related genes in the mycelia, such as glutamate dehydrogenase (GDH), glutamate synthase (GOGAT), glutamine synthetase (GS), ammonia transporter protein (AMT), and amino acid transporter protein (AAT), while upregulating its own ammonia-assimilation genes. These findings suggest that the mechanism by which B12 promoted oyster mushroom growth was that B12 assimilated ammonia, alleviated ammonia stress, mitigated ROS accumulation in the mycelia, and supplied ammonia and amino acids to the mycelia. To our knowledge, ammonia-assimilating bacteria are a novel type of mushroom growth promoter (MGP).

1. Introduction

Edible mushrooms are a valuable source of food and medicine. Global mushroom production has increased more than fivefold since 2000 and currently stands at 44 million tons [1]. The largest contributor was Lentinula edodes (shiitake mushroom) at 26%, followed by Pleurotus ostreatus (oyster mushroom) (21%), Auricularia species (black ear mushroom) (21%), Agaricus bisporus (button mushroom) (11%), Flammulina velutipes (7%), Volvariella volvacea (paddy straw mushroom) (1%), and other mushrooms (13%) [2]. The cultivation of edible mushrooms using agricultural and agro-industrial residues not only contributes significantly to the recycling of environmental wastes [3], but also generates numerous employment opportunities [4].
Mushroom life is closely related to other microorganisms, many of which are able to promote the growth of mushrooms, and referred to as mushroom growth-promoting microorganisms or mushroom growth promoters (MGP) [5]. Certain bacteria in the soil, compost, pasteurized substrate, and casing provide nutrients and a favorable environment for mushroom growth. The phylum Bacteroidetes in the soil provides available carbon sources for morels by degrading cellulose and chitin [6]. The spore formers [7], Bradirhizobium spp. [8], and other bacterial strains [9] isolated from truffles or truffle ectomycorrhizas promote the growth of the truffle mycelia and probably the establishment of symbiotic collaborations. The dominant thermophilic fungus Mycothermus thermophilus (previously Scytalidium thermophilum or Torula thermophila) [10] in compost produces dozens of lignocellulose-degrading enzymes [11] that degrade lignocellulose to provide nutrients for button mushrooms. The predominant Bacillales bacteria during compost conditioning may contribute to the removal of free ammonia in the compost [12] and eliminate the negative impact on button mushroom mycelial growth [13].
Many bacterial strains are selected as potent MGP for inoculation [14]. A fungus-derived Rhizobium strain promotes the mycelial growth of Polyporus umbellatus and Armillaria gallica [15]. Inoculation of Pseudomonas putida strains and other bacterial inoculation in the casing soil increases button mushroom yield by 12–215% [16,17,18]. Inoculation of Glutamicibacter arilaitensis MRC119 promotes the mycelial growth and yield of oyster mushrooms [19]. However, the growth-promoting mechanism of the MGPBs remains unclear. The inoculation of Pseudomonas sp. UW4 in casing soil induces primordial formation and enhances the button mushroom yields. The mechanism is that UW4 produces 1-aminocyclopropane-1-carboxylic acid (ACC) deaminase, which cleaves ACC produced by the mushroom mycelia, reduces ethylene synthesis, and relieves the inhibitory effect of ethylene on the primordial formation [20,21]. The indole acetic acid (IAA) producer Pseudomonas sp. P7014 promotes the mycelial growth of Pleurotus eryngii [22].
The other function of MGP is as a biocontrol agent. Inoculation of the substrate with Bacillus velezensis QST713 reduces the abundance of the pathogen Trichoderma aggressivum in button mushroom compost [23]. Inoculation of the compost and casing soil with Streptomyces flavovirens A06 [24], Pseudomonas spp., and Bacillus subtilis [25] controls compost green mold disease and button mushroom brown blotch disease. However, ammonia-assimilating bacteria have not yet been characterized as MGP inoculation.
Ammonia-assimilating bacteria, which utilize ammonia by assimilation rather than nitrification [26], are prevalent in ammonia-rich environments such as the rumen [27] and compost [28,29]. These bacteria assimilate ammonia common to other organisms through the glutamate dehydrogenase (GDH) pathway and the glutamine synthetase (GS)/glutamate synthase (GOGAT) pathway [13]. Oyster mushroom compost undergoes a short composting process, and the ammonia content in the compost was higher than 0.24% [29]. In a previous study, the ammonia assimilation characteristics of the ammonia-assimilating bacterium Enterobacter sp. B12, isolated from the compost of oyster mushrooms, were identified. Its ammonia assimilation-related genes include the GDH gene (gdhA), the GS gene (glnA), the GOGAT gene (gltD), and the ammonia transporter protein gene (amtB). As a new type of plant growth-promoting rhizobacteria (PGPR), Enterobacter sp. B12 promotes plant growth by assimilating ammonia, reducing nitrogen loss, and providing ammonia and amino acids to the plant, increasing plant antioxidant capacity and ammonia tolerance [13]. Oyster mushrooms are one of the most widely cultivated edible mushrooms and are often grown on compost. However, the high concentration of ammonia in compost inhibits the mushrooms’ growth. This study aims to investigate whether B12 promotes the growth of oyster mushrooms on compost and to elucidate the mechanism of growth promotion.

2. Materials and Methods

2.1. Strains

Pleurotus ostreatus Po164 was provided by the Edible Fungi Germplasm Bank of the Henan Academy of Agricultural Sciences and was maintained and incubated on potato dextrose agar (PDA) medium. Enterobacter B12, isolated from oyster mushroom compost, was maintained and incubated on an ammonia–nitrogen medium [13].

2.2. Preparation of Ammonia Assimilation Bacterial Inoculum

Enterobacter B12 was shaking-flask cultured in a trypticasein soy broth (TSB) medium at 30 °C and 220 rpm for 24 h. The culture broth was then mixed with steam-sterilized peat and incubated at 28 °C for 5 d to prepare the inoculum. The bacterial count in the inoculum was determined by plate counting and was 2.2 × 108 CFU/g.

2.3. Growing Oyster Mushrooms on Compost

Compost preparation and oyster mushroom culture management were performed as previously described [30]. A total of four treatments were set up: (1) control without B12 inoculum before and after composting (− −); (2) inoculation of B12 inoculum only before composting (+ −); (3) inoculation of B12 inoculum only after composting (− +); (4) inoculation of B12 inoculum before and after composting (+ +).

2.4. Co-Culture of Pleurotus ostreatus and Enterobacter sp. B12 on Plates

Mycelial plugs (1 cm in diameter) of Po164 were inoculated at the center of PDA plates containing 0 mM, 100 mM, or 200 mM NH4Cl, respectively. The plates were incubated at 25 °C. When the colony reached a diameter of 4 cm, 30 μL of B12 suspension (OD600 = 1.0) was inoculated at the mycelial edge. The radial growth of the mycelium was measured daily, and the growth curve was plotted. The slope of the curve during the rapid growth phase represented the mycelial growth rate.

2.5. Determination of Ammoniacal Nitrogen and Total Nitrogen

Ammoniacal nitrogen and total nitrogen in the fully colonized oyster mushroom mycelial compost were determined by the Kjeldahl method and flow injection analysis [31].

2.6. Enzyme Activity Assay

As the oyster mushroom mycelia spread across the plates, the surface mycelia from the region where both the mycelia and B12 coexisted were collected for qPCR analysis and enzyme activity assays. The activities of superoxide dismutase (SOD), peroxidase (POD), catalase (CAT), glutamine synthetase (GS), glutamate synthase (GOGAT), and glutamate dehydrogenase (GDH) were assessed using assay kits (Table 1) following the manufacturer’s instructions.

2.7. Mycelial Reactive Oxygen Species (ROS) Detection

ROS produced by mycelia climbing onto the coverslip was determined using the oxidant-sensitive probe dichlorodihydrofluorescein diacetate (H2DCFDA), as described elsewhere [32]. Slides were observed and imaged by using a confocal fluorescence microscope (Nikon A1HD25, Tokyo, Japan).

2.8. Quantitative RT-PCR

Total RNA from oyster mushroom mycelia and co-cultured Enterobacter sp. B12 was extracted using TRIeasy™ Total RNA Extraction Reagent (Yeasen, Shanghai, China). Total RNA was utilized as a template for quantitative RT-PCR to assess the expression of genes associated with ammonia assimilation and nitrogen metabolism, as well as the ROS-generating enzymes NADPH oxidase A (NOXA) [33] and the stress hormone ethylene synthase gene 1-aminocyclopropane-1-carboxylate oxidase (ACO) in oyster mushroom mycelia and B12. The primers are listed in Table 2. The reference genes for P. ostreatus and Enterobacter sp. B12 were UBQ and rpoB. The relative gene expression level was calculated using the 2−ΔΔCT method [34].

2.9. Statistical Analysis

All experiments were conducted at least three times, with each assay performed in triplicate. The means from these three independent experiments were compared using one-way ANOVA followed by Tukey’s multiple-comparison test.

3. Results

3.1. Application of Enterobacter sp. B12 in the Cultivation of Oyster Mushrooms with Compost

Inoculation of the oyster mushroom culture substrate with Enterobacter sp. B12 inoculum resulted in a faster temperature rise and reduced composting time by one day compared to the control without inoculum. After composting, the inoculation of oyster mushrooms, and cultivation until the culture bags were completely colonized by mycelia, whether B12 was inoculated before or after composting, the ammonia nitrogen content in the compost decreased, the total nitrogen content increased, and the yield of first-crop mushrooms increased. In particular, inoculation of B12 before and after composting proved to be particularly effective (Figure 1).

3.2. Impact of Enterobacter B12 on Mycelial Growth of Pleurotus ostreatus in Ammonia-Rich Medium

P. ostreatus Po164 was grown on PDA plates containing different concentrations of ammonia; 100 mM and 200 mM ammonia inhibited the mycelial growth compared to 0 mM ammonia. When Enterobacter B12 was inoculated at the edge of the colony, B12 inhibited the mycelial growth when the ammonia concentration was 0 and 100 mM, which may be due to nutrient competition between B12 and the mycelia. However, when the ammonia concentration was 200 mM, B12 promoted the mycelial growth (Figure 2).

3.3. Effect of Enterobacter sp. B12 on the Activities of ROS-Scavenging Enzymes and Ammonia Assimilating Enzymes in the P. ostreatus Mycelia and Mycelia–B12 Co-Culture System

P. ostreatus Po164 was grown on PDA plates containing different concentrations of ammonia; 200 mM ammonia decreased the activities of SOD and POD in the mycelia compared to 0 mM ammonia, while CAT activity was not different. When Enterobacter sp. B12 was co-cultured with the mycelia at 0 mM ammonia, B12 reduced SOD activity but did not change the activities of CAT and POD in the mycelia–B12 co-culture system compared to the mycelia growing alone at 0 mM ammonia. When Enterobacter sp. B12 was co-cultured with the mycelia at 200 mM ammonia, B12 increased all of the SOD, CAT, and POD activities in the mycelia–B12 co-culture system compared to the mycelia growing alone at 200 mM ammonia (Figure 3).
Po164 was grown on PDA plates containing different concentrations of ammonia; 200 mM ammonia decreased the activities of GDH and GOGAT in the mycelia compared to 0 mM ammonia, while GS activity was not different. When Enterobacter sp. B12 was co-cultured with the mycelia at 0 mM ammonia, B12 increased all of the GDH, GS, and GOGAT activities in the mycelia–B12 co-culture system compared to the mycelia growing alone at 0 mM ammonia. When Enterobacter sp. B12 was co-cultured with the mycelia at 200 mM ammonia, B12 increased all of GDH, GS, and GOGAT activities in the mycelia–B12 co-culture system compared to the mycelia growing alone at 200 mM ammonia (Figure 4).

3.4. Effect of Enterobacter sp. B12 on ROS Level in P. ostreatus Mycelia

P. ostreatus Po164 was grown on PDA plates containing 0 mM and 200 mM NH4Cl with Enterobacter sp. B12 inoculated at the edges of the mycelial colonies. A coverslip was placed outside the bacterial inoculation circle to observe the ROS level in the climbing mycelia. In 0 mM NH4Cl plates with and without B12, there was no accumulation of ROS in the mycelia. In PDA plates with 200 mM NH4Cl, obvious ROS accumulated in the mycelia without B12, but no ROS accumulated in the mycelia with B12 (Figure 5).

3.5. Gene Expression in P. ostreatus Mycelia and Enterobacter sp. B12 in Co-Culture

The mycelia of P. ostreatus Po164 was grown on PDA plates containing 200 mM NH4Cl; the expression of AMT, NOXA, and ACO was upregulated, while the expression of GDH, GOGAT, GS, and AAT was not changed compared to growing in 0 mM NH4Cl. When the mycelia co-cultured with Enterobacter sp. B12 at 200 mM NH4Cl, the expression of all the genes of GDH, GOGAT, GS, AMT, AAT, NOXA, and ACO were downregulated compared to the mycelia growing alone on the plates with 200 mM NH4Cl (Figure 6a,c). B12 was grown on PDA plates containing 200 mM NH4Cl; the expression of gdhA, glnA, and gltD was upregulated, but amtB was downregulated compared to growing in 0 mM NH4Cl. When co-cultured with Po164 mycelia, the expression of gdhA, glnA, and gltD was upregulated, but amtB was not changed compared to B12 growing alone (Figure 6b).

4. Discussion

Button mushrooms and oyster mushrooms are the two most widely grown edible mushrooms using compost. Composting produces a large amount of ammonia, reaching over 0.24% [28,29]. Ammonia levels in the compost at the time of spawning approaching 0.07% are inhibitory to button mushrooms [35]. Similarly, an ammonia concentration of more than 0.25% in the compost inhibits the growth of oyster mushrooms [36].
Ammonium assimilation in A. bisporus is mainly catalyzed by the GS/GOGAT pathway [37]. Ammonia and glutamine inhibit the activity of NADP-dependent glutamate dehydrogenase (NADP-GDH) and GOGAT [38,39], which may be the cause of ammonia intolerance in A. bisporus. The free ammonia produced during the composting phase I requires a conditioning process during phase II to reduce ammonia levels to approximately 0.001% in the button mushroom compost [40,41]. Ammonia assimilation in P. ostreatus is the only GS/GOGAT pathway [42]. High concentrations of ammonia and glutamate do not inhibit the activity of GS [43], which may be the reason why P. ostreatus has a higher ammonia tolerance than A. bisporus.
Ammonia toxicity primarily arises from non-ionic ammonium (NH3) rather than ionic ammonium (NH4+). NH3 is a fat-soluble component that can penetrate biofilms and enter cells, increasing the concentration of malondialdehyde (MDA) in the liver and decreasing the activity of superoxide dismutase (SOD), CAT, GSH-PX, and the relative expression levels of related genes [44,45]. Similarly, high ammonia stress leads to the accumulation of ROS in plant cells [46] and the release of ethylene [47]. Ammonia toxicity has not been well characterized in fungi. This study found that high ammonia inhibited the mycelial growth of P. ostreatus (Figure 2), reduced SOD and POD enzyme activities (Figure 3), induced ROS accumulation (Figure 5), and raised the expression of the ROS-generating enzyme gene NOXA and the stress hormone ethylene synthase gene ACO in P. ostreatus mycelia (Figure 6c).
In this study, the ammonia-assimilating bacterium Enterobacter sp. B12 accelerated the composting process, reduced the ammonia content, increased the total nitrogen content in the compost, improved the mushroom yield (Figure 1), and promoted the mycelial growth of P. ostreatus under high-ammonia conditions (200 mM ammonia) (Figure 2), establishing it as a novel MGP. Its growth-promoting mechanism is related to its ability to assimilate ammonia, reduce the ammonia concentration, increase the activities of ROS-scavenging enzymes (Figure 3) and ammonia-assimilating enzymes (Figure 4) in the P. ostreatus–B12 co-culture system, decrease the expression of NOXA and ACO genes in mycelia (Figure 6c), and mitigate ammonia stress-induced ROS accumulation in mycelia (Figure 3). The activities of ROS-scavenging enzymes and ammonia-assimilating enzymes in the P. ostreatus–B12 co-culture system are derived from both mycelia and B12. However, since the expression of ammonia-assimilating enzyme genes in mycelia is downregulated in the co-culture system (Figure 6a), while those in B12 are upregulated (Figure 6b), the increased activity of ammonia-assimilating enzymes in the co-culture system primarily originated from B12.
In this study, we also observed a remarkable event. When P. ostreatus mycelia were co-cultured with Enterobacter sp. B12 at high ammonia, the ammonia-assimilating enzyme activities of B12 increased (Figure 4), and its ammonia assimilation-related genes were upregulated (Figure 6b). In contrast, the ammonia assimilation genes were downregulated in the mycelia, along with the expression of AMT and AAT (Figure 6b), similar to that in the B12–wheat co-culture system [13]. This suggests the presence of ammonia and amino acid exchange between B12 and the mycelia. Such an exchange of NH4+ and NO3− has only been reported between mycorrhizal fungi and plants [48], and possibly with amino acid exchange [49,50]. Correspondingly, inoculation with arbuscular mycorrhizal fungi downregulated the abundance of ammonium transporters ZmAMT1;1a and ZmAMT1;3, which absorb NH4+ in maize roots, upregulated ZmAMT3;1, which transports ammonium across the peri-arbuscular membrane (PAM) [51], and also downregulated the expression of the ammonium transporter genes in roots of wheat [52] and Catalpa bungei [53]. Thus, B12 and P. ostreatus formed a close symbiotic association in nitrogen metabolism.

5. Conclusions

High concentrations of ammonia inhibited the mycelial growth of P. ostreatus, decreased the activities of SOD and POD, induced the accumulation of reactive oxygen species (ROS), and increased the expression of NOXA and ACO genes. However, the ammonia-assimilating bacterium Enterobacter sp. B12 accelerated the composting process of oyster mushroom substrates, reduced ammonia levels while increasing total nitrogen content in the compost, increased mushroom yield, and promoted mycelial growth of P. ostreatus under high-ammonia conditions. Its growth-promoting mechanism is likely to involve ammonia assimilation, which reduces ammonia concentration, mitigates ROS accumulation in the mycelia caused by ammonia stress, and supplies ammonia and amino acids to the mycelia. To the best of our knowledge, ammonia-assimilating bacteria represent a novel type of MGP. Overall, inoculating the culture substrate either prior to or after composting with ammonia-assimilating bacterium is a straightforward approach to promoting oyster mushroom growth.

Author Contributions

Conceptualization, Y.G., W.K. and L.Q.; methodology, R.L., Q.Z., Y.C. and Y.G.; investigation, R.L., Q.Z., Y.C., Y.Y., H.C. and B.S.; resources, Q.L., Y.G. and Y.L.; writing—original draft preparation, Y.G. and W.K.; writing—review and editing, L.Q. All authors have read and agreed to the published version of the manuscript.

Funding

This research was funded by the Henan Province Major Public Welfare Project (201300110700), the Henan Province Scientific and Technological Project (222102110302, 242102110311) and the Key Research Project of Henan Colleges and Universities (22B180004).

Institutional Review Board Statement

Not applicable.

Informed Consent Statement

Not applicable.

Data Availability Statement

The original contributions presented in this study are included in the article. Further inquiries can be directed to the corresponding authors.

Conflicts of Interest

The authors declare no conflicts of interest.

References

  1. FAOSTAT. Food and Agriculture Organization of the United Nations Statistics Database. Available online: http://www.fao.org/faostat/en/#data (accessed on 12 January 2025).
  2. Bijla, S. Status of mushroom production: Global and national scenario. Mushroom Res. 2023, 32, 91–98. [Google Scholar] [CrossRef]
  3. Chang, S.T.; Miles, P.G. Mushroom biology-A new discipline. Mycologist 1992, 6, 64–65. [Google Scholar] [CrossRef]
  4. Islam, M.K.; Khan, M.M.H.; Islam, M.N. An unrealized manner for poverty alleviation. Mushroom Ind. Dhaka Univ. J. Mark. 2013, 16, 43–56. [Google Scholar]
  5. Großkopf, T.; Soyer, O.S. Synthetic microbial communities. Curr Opin Microbiol 2014, 18, 72–77. [Google Scholar] [CrossRef] [PubMed]
  6. Liu, Q.; Liu, H.; Chen, C.; Wang, J.; Han, Y.; Long, Z. Effects of element complexes containing Fe, Zn and Mn on artificial morel’s biological characteristics and soil bacterial community structures. PLoS ONE 2017, 12, e0174618. [Google Scholar] [CrossRef] [PubMed]
  7. Sbrana, C.; Agnolucci, M.; Bedini, S.; Lepera, A.; Toffanin, A.; Giovannetti, M.; Nuti, M.P. Diversity of culturable bacterial populations associated to Tuber borchii ectomycorrhizas and their activity on T. borchii mycelial growth. FEMS Microbiol. Lett. 2002, 211, 195–201. [Google Scholar] [CrossRef] [PubMed]
  8. Graziosi, S.; Puliga, F.; Iotti, M.; Amicucci, A.; Zambonelli, A. In vitro interactions between Bradyrhizobium spp. and Tuber magnatum mycelium. Environ. Microbiol. Rep. 2024, 16, e13271. [Google Scholar] [CrossRef] [PubMed]
  9. Iotti, M.; Piattoni, F.; Zambonelli, A. Techniques for host plant inoculation with truffles and other edible ectomycorrhizal mushrooms. In Edible Ectomycorrhizal Mushrooms: Current Knowledge and Future Prospects, Soil Biology; Zambonelli, A., Bonito, G.M., Eds.; Springer: Berlin/Heidelberg, Germany, 2012; pp. 145–161. [Google Scholar]
  10. Natvig, D.O.; Taylor, J.W.; Tsang, A.; Hutchinson, M.I.; Powell, A.J. Mycothermus thermophilus gen. et comb. nov. A new home for the itinerant thermophile Scytalidium thermophilum (Torula thermophila). Mycologia 2015, 107, 319–327. [Google Scholar] [CrossRef] [PubMed]
  11. Basotra, N.; Kaur, B.; Di Falco, M.; Tsang, A.; Chadha, B.S. Mycothermus thermophilus (Syn. Scytalidium thermophilum): Repertoire of a diverse array of efficient cellulases and hemicellulases in the secretome revealed. Bioresour. Technol. 2016, 222, 413–421. [Google Scholar] [CrossRef]
  12. Vieira, F.R.; Pecchia, J.A. An exploration into the bacterial community under different pasteurization conditions during substrate preparation (composting phase II) for Agaricus bisporus cultivation. Microb. Ecol. 2018, 75, 318–330. [Google Scholar] [CrossRef]
  13. Gao, Y.; Zhang, Q.; Chen, Y.; Yang, Y.; Zhou, C.; Yu, J.; Li, Y.; Qiu, L. Ammonia-assimilating bacteria promote wheat (Triticum aestivum) growth and nitrogen utilization. Microorganisms 2025, 13, 43. [Google Scholar] [CrossRef]
  14. Cetin, M.; Atila, F. The potential of bioinoculants in enhancing the mushroom productivity. In BIO Web of Conferences; EDP Sciences: Les Ulis, France, 2024; Volume 85, p. 01049. [Google Scholar]
  15. Hua, Z.; Liu, T.; Han, P.; Zhou, J.; Zhao, Y.; Huang, L.; Yuan, Y. Isolation, genomic characterization, and mushroom growth-promoting effect of the first fungus-derived Rhizobium. Front. Microbiol. 2022, 13, 947687. [Google Scholar] [CrossRef] [PubMed]
  16. Zarenejad, F.; Yakhchali, B.; Rasooli, I. Evaluation of indigenous potent mushroom growth promoting bacteria (MGPB) on Agaricus bisporus production. World J. Microbiol. Biotechnol. 2012, 28, 99–104. [Google Scholar] [CrossRef] [PubMed]
  17. Mohammad, A.; Sabaa, A.K. In vitro and in vivo impact of some Pseudomonas spp. on growth and yield of cultivated mushroom (Agaricus bisporus). Egypt. Soc. Exp. Biol. 2015, 11, 163–167. [Google Scholar] [CrossRef]
  18. Young, L.S.; Chu, J.N.; Hameed, A.; Young, C.C. Cultivable mushroom growth-promoting bacteria and their impact on Agaricus blazei productivity. Pesqui. Agropecuária Bras. 2013, 48, 636–644. [Google Scholar] [CrossRef]
  19. Kumari, S.; Naraian, R. Enhanced growth and yield of oyster mushroom by growth-promoting bacteria Glutamicibacter arilaitensis MRC119. J. Basic Microbiol. 2021, 61, 45–54. [Google Scholar] [CrossRef] [PubMed]
  20. Chen, S.; Qiu, C.; Huang, T.; Zhou, W.; Qi, Y.; Gao, Y.; Shen, J.; Qiu, L. Effect of 1-aminocyclopropane-1-carboxylic acid deaminase producing bacteria on the hyphal growth and primordium initiation of Agaricus bisporus. Fungal Ecol. 2013, 6, 110–118. [Google Scholar] [CrossRef]
  21. Zhang, C.; Zhang, G.; Wen, Y.; Li, T.; Gao, Y.; Meng, F.; Qiu, L.; Ai, Y. Pseudomonas sp. UW4 acdS gene promotes primordium initiation and fruiting body development of Agaricus bisporus. World J. Microbiol. Biotechnol. 2019, 35, 163. [Google Scholar] [CrossRef] [PubMed]
  22. Kang, Y.M.; Cho, K.M. Identification of auxin from Pseudomonas sp. P7014 for the rapid growth of Pleurotus eryngii mycelium. Korean J. Microbiol. 2014, 50, 15–21. [Google Scholar] [CrossRef]
  23. Pandin, C.; Védie, R.; Rousseau, T.; Le Coq, D.; Aymerich, S.; Briandet, R. Dynamics of compost microbiota during the cultivation of Agaricus bisporus in the presence of Bacillus velezensis QST713 as biocontrol agent against Trichoderma aggressivum. Biol. Control 2018, 127, 39–54. [Google Scholar] [CrossRef]
  24. Šantrić, L.; Potočnik, I.; Radivojević, L.; Umiljendić, J.G.; Rekanović, E.; Duduk, B.; Milijašević-Marčić, S. Impact of a native Streptomyces flavovirens from mushroom compost on green mold control and yield of Agaricus bisporus. J. Environ. Sci. Health Part B 2018, 53, 677–684. [Google Scholar] [CrossRef] [PubMed]
  25. Tajalipour, S.; Hassanzadeh, N.; Khabbaz Jolfaee, H.; Heydari, A.; Ghasemi, A. Biological control of mushroom brown blotch disease using antagonistic bacteria. Biocontrol Sci. Technol. 2014, 24, 473–484. [Google Scholar] [CrossRef]
  26. Sasaki, H.; Maruyama, G.; Suzuki, H.; Nonaka, J.; Sato, M.; Sasaki, T.; Ohta, M.; Nakai, Y. Distribution of ammonia assimilating bacteria in the composting process. Compos. Sci. Util. 2004, 12, 108–113. [Google Scholar] [CrossRef]
  27. Wang, P.; Tan, Z.; Guan, L.; Tang, S.; Zhou, C.; Han, X.; Kang, J.; He, Z. Ammonia and amino acids modulates enzymes associated with ammonia assimilation pathway by ruminal microbiota in vitro. Livest. Sci. 2015, 178, 130–139. [Google Scholar] [CrossRef]
  28. Sharma, H.S.S.; Kilpatrick, M.; Lyons, G.; Murray, J.; Moore, S.; Cheung, L.; Finnegan, K.; Sturgeon, S.; Mellon, R. Changes in the quality of mushroom compost during the last decade. In Science and Cultivation of Edible and Medicinal Fungi; Romaine, P., Keil, C.B., Rinker, D.L., Royse, D.J., Eds.; Pennsylvania State University: Pennsylvania, PA, USA, 2004; pp. 229–239. [Google Scholar]
  29. Kong, W.; Guo, J.; Liu, Q.; Qi, M.; Cui, X.; Li, Y.; Gao, Y.; Qiu, L.; Zhang, Y. Establishment of the fast determination index for the compost degree of oyster mushroom substrate. China Cucurbits Veg. 2021, 34, 54–60. [Google Scholar]
  30. Liu, Q.; Kong, W.; Cui, X.; Hu, S.; Shi, Z.; Wu, J.; Zhang, Y.; Qiu, L. Dynamic succession of microbial compost communities and functions during Pleurotus ostreatus mushroom cropping on a short composting substrate. Front. Microbiol. 2022, 13, 946777. [Google Scholar] [CrossRef]
  31. Raigón, M.D.; García, M.; Maquieira, A.; Puchades, R. Determination of available nitrogen (nitic and ammoniacal) in soils by flow-injection analysis. Analysis 1992, 20, 483–487. [Google Scholar]
  32. Machida, K.; Tanaka, T.; Fujita, K.I.; Taniguchi, M. Farnesol-induced generation of reactive oxygen species via indirect inhibition of the mitochondrial electron transport chain in the yeast Saccharomyces cerevisiae. J. Bacteriol. 1998, 180, 4460–4465. [Google Scholar] [CrossRef] [PubMed]
  33. Zuo, Y.; Yang, Q.; Li, Y.; Zhang, J.; Qi, Y.; Gao, Y.; Shen, J.; Qiu, L. Functions and bioinformatics analysis of the NADPH oxidase NoxA in basidiomycete Pleurotus ostreatus: ROS production and fruiting body formation. Acad. J. Agric. Res. 2016, 4, 218–229. [Google Scholar]
  34. Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2−ΔΔCT method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef]
  35. Wuest, P.; Duffy, M.D.; Royse, D.J. Six steps to mushroom farming. In Special Circular 268; The Pennsylvania State University, College of Agriculture, Extension Service: University Park, PA, USA, 1980. [Google Scholar]
  36. Li, Y.; Zhang, Y.; Shang, D.; Gao, Y.; Liu, Q.; Cui, X.; Kong, W.; Qiu, L. Ammonia tolerance of different Pleurotus ostreatus strains. Acta Edulis Fungi 2021, 28, 57–63. [Google Scholar]
  37. Baars, J.J.; den Camp, H.J.O.; van der Drift, C.; Joordens, J.J.; Wijmenga, S.S.; van Griensven, L.J.; Vogels, G.D. 15N-NMR study of ammonium assimilation in Agaricus bisporus. Biochim. Biophys. Acta (BBA)-Mol. Cell Res. 1996, 1310, 74–80. [Google Scholar] [CrossRef]
  38. Baars, J.J.; Op den Camp, H.J.; van der Drift, C.; Van Griensven, L.J.; Vogels, G.D. Regulation of nitrogen-metabolizing enzymes in the commercial mushroom Agaricus bisporus. Curr. Microbiol. 1995, 31, 345–350. [Google Scholar] [CrossRef]
  39. Baars, J.J.; Op den Camp, H.J.; Hermans, J.M.; Mikeš, V.; van der Drift, C.; Van Griensven, L.J.; Vogels, G.D. Nitrogen assimilating enzymes in the white button mushroom Agaricus bisporus. Microbiology 1994, 140, 1161–1168. [Google Scholar] [CrossRef]
  40. Hubbe, M.A.; Nazhad, M.; Snchez, C. Composting as a way to convert cellulosic biomass and organic waste into high-value soil amendments: A review. BioResources 2010, 5, 2808–2854. [Google Scholar] [CrossRef]
  41. Ross, R.C.; Harris, P.J. The significance of thermophilic fungi in mushroom compost preparation. Sci. Hortic. 1983, 20, 61–70. [Google Scholar] [CrossRef]
  42. Rudolfová, J.; Mikeš, V. Involvement of the glutamine synthetase/glutamate synthase pathway in ammonia assimilation by the wood-rotting fungus Pleurotus ostreatus. Folia Microbiol. 1997, 42, 577–582. [Google Scholar] [CrossRef]
  43. Mikeš, V.; Zofall, M.; Chytil, M.; Fulneček, J.; Scháně, L. Ammonia-assimilating enzymes in the basidiomycete fungus Pleurotus ostreatus. Microbiology 1994, 140, 977–982. [Google Scholar] [CrossRef]
  44. Xu, Z.; Cao, J.; Qin, X.; Qiu, W.; Mei, J.; Xie, J. Toxic effects on bioaccumulation, hematological parameters, oxidative stress, immune responses and tissue structure in fish exposed to ammonia nitrogen: A review. Animals 2021, 11, 3304. [Google Scholar] [CrossRef]
  45. Sun, Y.; Fu, Z.; Ma, Z. The effects of acute ammonia stress on liver antioxidant, immune and metabolic responses of juvenile yellowfin tuna (Thunnus albacares). Comp. Biochem. Physiol. Part A Mol. Integr. Physiol. 2024, 297, 111707. [Google Scholar] [CrossRef]
  46. Wang, C.; Zhang, S.H.; Wang, P.F.; Hou, J.; Li, W.; Zhang, W.J. Metabolic adaptations to ammonia-induced oxidative stress in leaves of the submerged macrophyte Vallisneria natans (Lour.) Hara. Aquat. Toxicol. 2008, 87, 88–98. [Google Scholar] [CrossRef]
  47. Barker, A.V. Ammonium accumulation and ethylene evolution by tomato infected with root-knot nematode and grown under different regimes of plant nutrition. Commun. Soil Sci. Plant Anal. 1999, 30, 175–182. [Google Scholar] [CrossRef]
  48. Shi, J.; Wang, X.; Wang, E. Mycorrhizal symbiosis in plant growth and stress adaptation: From genes to ecosystems. Annu. Rev. Plant Biol. 2023, 74, 569–607. [Google Scholar] [CrossRef] [PubMed]
  49. Hortal, S.; Plett, K.L.; Plett, J.M.; Cresswell, T.; Johansen, M.; Pendall, E.; Anderson, I.C. Role of plant–fungal nutrient trading and host control in determining the competitive success of ectomycorrhizal fungi. ISME J. 2017, 11, 2666–2676. [Google Scholar] [CrossRef]
  50. Larsen, P.E.; Sreedasyam, A.; Trivedi, G.; Podila, G.K.; Cseke, L.J.; Collart, F.R. Using next generation transcriptome sequencing to predict an ectomycorrhizal metabolome. BMC Syst. Biol. 2011, 5, 70. [Google Scholar] [CrossRef] [PubMed]
  51. Hui, J.; An, X.; Li, Z.; Neuhauser, B.; Ludewig, U.; Wu, X.; Schulze, W.X.; Chen, F.; Feng, G.; Lambers, H.; et al. The mycorrhiza-specific ammonium transporter ZmAMT3;1 mediates mycorrhiza-dependent nitrogen uptake in maize roots. Plant Cell 2022, 34, 4066–4087. [Google Scholar] [CrossRef]
  52. Duan, J.; Tian, H.; Drijber, R.A.; Gao, Y. Systemic and local regulation of phosphate and nitrogen transporter genes by arbuscular mycorrhizal fungi in roots of winter wheat (Triticum aestivum L.). Plant Physiol. Biochem. 2015, 96, 199–208. [Google Scholar] [CrossRef]
  53. Chen, W.; Mou, X.; Meng, P.; Chen, J.; Tang, X.; Meng, G.; Xin, K.; Zhang, Y.; Wang, C. Effects of arbuscular mycorrhizal fungus inoculation on the growth and nitrogen metabolism of Catalpa bungei CA Mey under different nitrogen levels. Front. Plant Sci. 2023, 14, 1138184. [Google Scholar]
Jof 11 00130 g001
Figure 1. Effect of inoculation of oyster mushroom culture substrate with Enterobacter sp. B12 on ammonia nitrogen, total nitrogen in compost, and mushroom yield. (a) Ammonia nitrogen and total nitrogen content in compost. (b) Fresh weight of the first-crop mushrooms. − −, control without B12 inoculum before and after composting; + −, inoculation of B12 inoculum only before composting; − +, inoculation of B12 inoculum only after composting; + +, inoculation of B12 inoculum before and after composting. AN, ammonia nitrogen; TN, total nitrogen; same color bars with different lowercase letters indicated significant difference (p < 0.05).
Figure 1. Effect of inoculation of oyster mushroom culture substrate with Enterobacter sp. B12 on ammonia nitrogen, total nitrogen in compost, and mushroom yield. (a) Ammonia nitrogen and total nitrogen content in compost. (b) Fresh weight of the first-crop mushrooms. − −, control without B12 inoculum before and after composting; + −, inoculation of B12 inoculum only before composting; − +, inoculation of B12 inoculum only after composting; + +, inoculation of B12 inoculum before and after composting. AN, ammonia nitrogen; TN, total nitrogen; same color bars with different lowercase letters indicated significant difference (p < 0.05).
Jof 11 00130 g001
Jof 11 00130 g002
Figure 2. Effects of Enterobacter sp. B12 on the growth of P. ostreatus mycelia co-cultured on PDA plates with varying concentrations of ammonia. Ctr, control; B12, Enterobacter sp. B12. Bars marked with different lowercase letters showed a significant difference (p < 005).
Figure 2. Effects of Enterobacter sp. B12 on the growth of P. ostreatus mycelia co-cultured on PDA plates with varying concentrations of ammonia. Ctr, control; B12, Enterobacter sp. B12. Bars marked with different lowercase letters showed a significant difference (p < 005).
Jof 11 00130 g002
Jof 11 00130 g003
Figure 3. Activities of ROS-scavenging enzymes in P. ostreatus Po164 mycelia and mycelia–B12 co-culture system growing on PDA plates containing 0 mM and 200 mM NH4+Cl. (a) SOD activity. (b) CAT activity. (c) POD activity. Ctr, control; B12, Enterobacter sp. B12. Bars marked with different lowercase letters showed a significant difference (p < 005).
Figure 3. Activities of ROS-scavenging enzymes in P. ostreatus Po164 mycelia and mycelia–B12 co-culture system growing on PDA plates containing 0 mM and 200 mM NH4+Cl. (a) SOD activity. (b) CAT activity. (c) POD activity. Ctr, control; B12, Enterobacter sp. B12. Bars marked with different lowercase letters showed a significant difference (p < 005).
Jof 11 00130 g003
Jof 11 00130 g004
Figure 4. Activities of ammonia assimilating enzymes in P. ostreatus Po164 mycelia and the mycelia–B12 co-culture system growing on PDA plates containing 0 mM and 200 mM NH4Cl. (a) GDH activity. (b) GS activity. (c) GOGAT activity. Ctr, control; B12, Enterobacter sp. B12. Bars marked with different lowercase letters showed a significant difference (p < 005).
Figure 4. Activities of ammonia assimilating enzymes in P. ostreatus Po164 mycelia and the mycelia–B12 co-culture system growing on PDA plates containing 0 mM and 200 mM NH4Cl. (a) GDH activity. (b) GS activity. (c) GOGAT activity. Ctr, control; B12, Enterobacter sp. B12. Bars marked with different lowercase letters showed a significant difference (p < 005).
Jof 11 00130 g004
Jof 11 00130 g005
Figure 5. ROS levels in P. ostreatus mycelia induced by ammonia. Ctr, control; B12, Enterobacter sp. B12. Scale bars are 100 µm.
Figure 5. ROS levels in P. ostreatus mycelia induced by ammonia. Ctr, control; B12, Enterobacter sp. B12. Scale bars are 100 µm.
Jof 11 00130 g005
Jof 11 00130 g006
Figure 6. Effect of co-culture on the gene expression in P. ostreatus mycelia and Enterobacter sp. B12 on PDA plates with 200 mM NH4Cl. (a) The gene expression level in mycelia was related to the mycelia growing alone in the plates without NH4Cl. Ctr, control; B12, mycelia co-cultured with Enterobacter sp. B12. Bars marked # indicated a significant difference (p < 0.05) to the gene expression level in mycelia growing alone in the plates without NH4Cl; bars marked * showed a significant difference (p < 0.05) to the gene expression level in mycelia growing alone in the plates with 200 mM NH4Cl. (b) The gene expression level was related to B12 culturing on the plates without NH4Cl. B12, Enterobacter sp. B12 growing alone; B12 + Po164, Enterobacter sp. B12 co-cultured with Po164 mycelia. Bars marked # indicated a significant difference (p < 0.05) to the gene expression level in B12 growing alone on the plates without NH4Cl; bars marked * showed a significant difference (p < 005) to the gene expression level in B12 growing alone on the plates with 200 mM NH4Cl. (c) The gene expression level was related to the mycelia growing alone on the plates without NH4Cl. Ctr, control; B12, mycelia co-cultured with Enterobacter sp. B12. Bars marked # indicated a significant difference at p < 005 to the gene expression level in the mycelia growing alone in the plates without NH4Cl; bars marked * showed a significant difference at p < 005 to the gene expression level in the mycelia growing alone on the plates with 200 mM NH4Cl.
Figure 6. Effect of co-culture on the gene expression in P. ostreatus mycelia and Enterobacter sp. B12 on PDA plates with 200 mM NH4Cl. (a) The gene expression level in mycelia was related to the mycelia growing alone in the plates without NH4Cl. Ctr, control; B12, mycelia co-cultured with Enterobacter sp. B12. Bars marked # indicated a significant difference (p < 0.05) to the gene expression level in mycelia growing alone in the plates without NH4Cl; bars marked * showed a significant difference (p < 0.05) to the gene expression level in mycelia growing alone in the plates with 200 mM NH4Cl. (b) The gene expression level was related to B12 culturing on the plates without NH4Cl. B12, Enterobacter sp. B12 growing alone; B12 + Po164, Enterobacter sp. B12 co-cultured with Po164 mycelia. Bars marked # indicated a significant difference (p < 0.05) to the gene expression level in B12 growing alone on the plates without NH4Cl; bars marked * showed a significant difference (p < 005) to the gene expression level in B12 growing alone on the plates with 200 mM NH4Cl. (c) The gene expression level was related to the mycelia growing alone on the plates without NH4Cl. Ctr, control; B12, mycelia co-cultured with Enterobacter sp. B12. Bars marked # indicated a significant difference at p < 005 to the gene expression level in the mycelia growing alone in the plates without NH4Cl; bars marked * showed a significant difference at p < 005 to the gene expression level in the mycelia growing alone on the plates with 200 mM NH4Cl.
Jof 11 00130 g006
Table 1. The kits used to measure the enzymatic activities.
Table 1. The kits used to measure the enzymatic activities.
Kit NameManufacturerItem No.Methodology
Superoxide Dismutase (SOD) Activity Assay KitSolarbio, Beijing, ChinaBC5165WST-1 method
Peroxidase (POD) Activity Assay KitSolarbio, Beijing, ChinaBC0090Spectrophotometry
Catalase (CAT) Activity Assay KitSolarbio, Beijing, ChinaBC4785Ammonium molybdate method
Micro Glutamine Synthetase (GS) Assay KitSolarbio, Beijing, ChinaBC0915Spectrophotometry
Micro Glutamate Synthase (GOGAT) Assay KitSolarbio, Beijing, ChinaBC0075Spectrophotometry
Micro Glutamic Acid Dehydrogenase (GDH) Assay KitSolarbio, Beijing, ChinaBC1460Spectrophotometry
Table 2. The primers used for quantitative RT-PCR.
Table 2. The primers used for quantitative RT-PCR.
SpeciesGenesForward Primers (5′→3′)Reverse Primers (5′→3′)
P. ostreatusUBQTCTGCTCGATGTTGACTGATCTATTTCCTCGTCCATTCCCT
ACOGGGCAATAATGTCTGGCTCAAGGCGTGGGATATTTCGTT
NOXAGCCGAGCGACTAGACTTTCCGTCACCGACTTGGCGAATG
GOGATGCTGGCGTCGGGCTTATTTTATGGTCGGCTTTGGCTTT
GSCCAAGAAGGCAGGCGAATCATAGCCACGCCGAACTCTG
AATGAACGCTCTACGGTCTCGCAAGACTCGGGCACTGGATG
AMTACCGCCTTGAGAAGAAATGGTGCCAACGATACCTCCAACA
GDHTTGAAGGCTCCGACCTGTTTGCGTTGACACCGTATTTGT
Enterobacter sp.glnACCAACCACCAACTCCTACAAGCGGGATACGGATAGAAGCAG
gltDAGTGACACGGGCAGCAAATTCGAGGCCACCCATGATAT
amtBGCAATGCGTTCTTTGGTAACTAGGCACATAGGAGAGCGTC
gdhATGTGAAATCAAAGCCAGCCCACGCCGTTGCTAATCAA
rpoBGCCAAGCCGATTTCTGGAGCACGTTTCGATTGGACATACG
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Li, R.; Zhang, Q.; Chen, Y.; Gao, Y.; Yang, Y.; Liu, Q.; Kong, W.; Chai, H.; Sun, B.; Li, Y.; et al. The Mechanism of Ammonia-Assimilating Bacteria Promoting the Growth of Oyster Mushrooms (Pleurotus ostreatus). J. Fungi 2025, 11, 130. https://doi.org/10.3390/jof11020130

AMA Style

Li R, Zhang Q, Chen Y, Gao Y, Yang Y, Liu Q, Kong W, Chai H, Sun B, Li Y, et al. The Mechanism of Ammonia-Assimilating Bacteria Promoting the Growth of Oyster Mushrooms (Pleurotus ostreatus). Journal of Fungi. 2025; 11(2):130. https://doi.org/10.3390/jof11020130

Chicago/Turabian Style

Li, Rui, Qi Zhang, Yuannan Chen, Yuqian Gao, Yanqing Yang, Qin Liu, Weili Kong, Haopeng Chai, Bingke Sun, Yanan Li, and et al. 2025. "The Mechanism of Ammonia-Assimilating Bacteria Promoting the Growth of Oyster Mushrooms (Pleurotus ostreatus)" Journal of Fungi 11, no. 2: 130. https://doi.org/10.3390/jof11020130

APA Style

Li, R., Zhang, Q., Chen, Y., Gao, Y., Yang, Y., Liu, Q., Kong, W., Chai, H., Sun, B., Li, Y., & Qiu, L. (2025). The Mechanism of Ammonia-Assimilating Bacteria Promoting the Growth of Oyster Mushrooms (Pleurotus ostreatus). Journal of Fungi, 11(2), 130. https://doi.org/10.3390/jof11020130

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop