Efficacy of Plant Tissue Culture Techniques for Eliminating Black Mulberry Idaeovirus (BMIV) from Infected Black Mulberry (Morus nigra)
Abstract
1. Introduction
2. Results and Discussion
2.1. In Vitro Establishment of Mulberry Accessions
2.2. Efficiency of the Treatments
2.2.1. Regeneration Rate
2.2.2. Virus Removal Efficiency
3. Materials and Methods
3.1. Plant Material and Shoot Initiation
3.2. Virus Elimination Experiments
3.2.1. Culture Media for Cryotherapy, Thermotherapy, Chemotherapy and Micropropagation
3.2.2. Chemotherapy (Ch)
3.2.3. Thermotherapy after Chemotherapy (Ch + Th1st)
3.2.4. Chemotherapy after Thermotherapy (Th2nd + Ch)
3.2.5. Cryotherapy (Cr)
3.2.6. Chemotherapy after PVS2 (Ch + PVS2)
3.3. Rooting and Acclimatization of Explants
3.4. Experimental Design and Statistical Analysis
3.5. Virus Indexing by RT-PCR
4. Conclusions
Supplementary Materials
Author Contributions
Funding
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Nepal, M.P.; Purintun, J.M. Systematics of the genus Morus L. (Moraceae) taxonomy, phylogeny and potential responses to climate change. In Mulberry: Genetic Improvement in Context of Climate Change; Razdan, M.K., Thomas, D.T., Eds.; CRC Press: Boca Raton, FL, USA, 2021; pp. 2–20. [Google Scholar]
- Lim, S.H.; Choi, C.I. Pharmacological properties of Morus nigra L. (black mulberry) as a promising Nutraceutical Resource. Nutrients 2019, 11, 437. [Google Scholar] [CrossRef] [PubMed]
- Cui, W.-S.; Zhang, Q.; Zhao, X.H. Impact of heat treatment on anti-oxidative and anti-colon cancer activities of the soluble extracts from black mulberry (Morus nigra L.) using water and ethanol–water solvents. RSC Adv. 2020, 10, 30415–30427. [Google Scholar] [CrossRef] [PubMed]
- Kilinçer, İ.; Khanyile, L.; Gürcan, K.; Şimşek, Ö.; Uzun, A.; Nikbakht-Dehkordi, A. Decosaploid sour black mulberry (Morus nigra L.) in Western Asia: Features, domestication history, and unique population genetics. Genet. Resour. Crop Evol. 2024, 71, 2229–2246. [Google Scholar] [CrossRef]
- Orwa, C.; Mutua, A.; Kindt, R.; Jamnadass, R.; Simons, A.J. Agroforestree Database: A Tree Reference and Selection Guide. 2009. Version 4. World Agroforestry Centre. Available online: https://worldagroforestry.org/output/agroforestree-database (accessed on 7 August 2024).
- Gürcan, K. Ekşi Karadutun (Morus nigra L.) Türkiye’de Yetiştiricilik Kültürü ve alanları: Asırlık Ağaçların keşfi. Eur. J. Sci. Technol. 2021, 31, 568–582. [Google Scholar] [CrossRef]
- Wang, W.B.; Fei, J.M.; Wu, Y.; Bai, X.C.; Yu, F.; Shi, G.F.; Li, Y.F.; Kuai, Y.Z. A new report of a mosaic dwarf viroid-like disease on mulberry trees in China. Pol. J. Microbiol. 2010, 59, 33–36. [Google Scholar] [CrossRef]
- Elbeaino, T.; Kubaa, R.A.; Choueiri, E.; Digiaro, M.; Navarro, B. Occurrence of hop stunt viroid in Mulberry (Morus alba) in Lebanon and Italy. J. Phytopathol. 2012, 160, 48–51. [Google Scholar] [CrossRef]
- Meng, J.; Liu., P.; Zhu, L.; Zou, C.; Li, J.; Chen, B. Complete Genome Sequence of Mulberry Vein Banding Associated Virus, a New Tospovirus Infecting Mulberry. PLoS ONE 2015, 10, e0136196. [Google Scholar] [CrossRef]
- Ma, Y.; Navarro, B.; Zhang, Z.; Lu, M.; Zhou, X.; Chi, S.; Di Serio, F.; Li, S. Identification and molecular characterization of a novel monopartite geminivirus associated with mulberry mosaic dwarf disease. J. Gen. Virol. 2015, 96, 2421–2434. [Google Scholar] [CrossRef]
- Lu, Q.Y.; Wu, Z.J.; Xia, Z.S.; Xie, L.H. A new nepovirus identified in mulberry (Morus alba L.) in China. Arch. Virol. 2015, 160, 851–855. [Google Scholar] [CrossRef]
- Alishiri, A.; Rakhshandehroo, F.; Shams-bakhsh, M.; Jouzani, M.R.S. Incidence and distribution of fig badnavirus 1 and mulberry badnavirus 1 on mulberry trees in Iran. J. Plant Pathol. 2016, 98, 341–345. [Google Scholar] [CrossRef]
- Chen, L.; Xu, Z.L.; Liu, P.G.; Zhu, Y.; Lin, T.B.; Li, T.Y.; Wei, J. Identification of Three Viruses Infecting Mulberry Varieties. Viruses 2022, 14, 2564. [Google Scholar] [CrossRef] [PubMed]
- Wei, J.; Chen, L.; Xu, Z.; Liu, P.; Zhu, Y.; Lin, T.; Lv, Z. Identification and Characterization of a Novel Quanzhou Mulberry Virus from Mulberry (Morus alba). Viruses 2023, 15, 1131. [Google Scholar] [CrossRef] [PubMed]
- Gürcan, K.; Turan, S.; Teber, S.; Kilinçer, I.; Uz, I.; Tamisier, L.; Massart, S.; Çağlayan, K. Molecular and biological characterization of a new mulberry idaeovirus. Virus Res. 2021, 298, 198411. [Google Scholar] [CrossRef] [PubMed]
- Aboughanem-Sabanadzovic, N.; Kuhn, J.H.; Rubino, L.; Sabanadzovic, S. Rename Species in the Family Mayoviridae to Comply with ICTV-Mandated BINOMIAL format (Martellivirales: Mayoviridae). 2021. Available online: https://ictv.global/ictv/proposals/2021.020P.R.Mayoviridae_binomials.zip (accessed on 7 August 2024).
- MacFarlane, S.A. Genus Idaeovirus. In Virus Taxonomy, Ninth Report of the International Committee on Taxonomy of Viruses; King, A.M.Q., Adams, M.J., Carstens, E.B., Lefkowitz, E.J., Eds.; Elsevier Academic Press: London, UK, 2012; pp. 1173–1175. [Google Scholar]
- Navarro, B.; Loconsole, G.; Giampetruzzi, A.; Aboughanem-Sabanadzovic, N.; Ragozzino, A.; Ragozzino, E.; Di Serio, F. Identification and characterization of privet leaf blotch-associated virus, a novel idaeovirus. Mol. Plant Pathol. 2016, 18, 925–936. [Google Scholar] [CrossRef]
- Derrick, K.S.; Beretta, M.J.; Barthe, G.A. Detection of an idaeovirus in citrus with implication as to the cause of citrus blight. Fla. State Hortic. Soc. 2006, 119, 69–72. [Google Scholar]
- James, D.; Phelan, J. Complete genome sequence and analysis of blackcurrant leaf chlorosis associated virus, a new member of the genus Idaeovirus. Arch. Virol. 2017, 161, 1705–1709. [Google Scholar] [CrossRef] [PubMed]
- Cao, M.; Zhang, S.; Li, M.; Liu, Y.; Dong, P.; Li, S.; Kuang, M.; Li, R.; Zhou, Y. Discovery of four novel viruses associated with flower yellowing disease of green sichuan pepper (Zanthoxylum armatum) by Virome analysis. Viruses 2019, 11, 696. [Google Scholar] [CrossRef]
- Rumbou, A.; Candresse, T.; Marais, A.; Svanella-Dumas, L.; Landgraf, M.; von Bargen, S.; Büttner, C. Unravelling the virome in birch: RNA-Seq reveals a complex of known and novel viruses. PLoS ONE 2020, 15, e0221834. [Google Scholar] [CrossRef]
- Zhang, S.; Yang, L.; Ma, L.; Tian, X.; Li, R.; Zhou, C.; Cao, M. Virome of Camellia japonica: Discovery of and Molecular Characterization of New Viruses of Different Taxa in Camellias. Front. Microbiol. 2020, 15, 945. [Google Scholar] [CrossRef]
- Murant, A.F.; Chambers, J.; Jones, A.T. Spread of raspberry bushy dwarf virus by pollination, its association with crumbly fruit, and problems of Control. Ann. Appl. Biol. 1974, 77, 271–281. [Google Scholar] [CrossRef]
- Strik, B.; Martin, R. Raspberry Bushy Dwarf Virus (RBDV) Reduces Yield of ‘Marion’ Blackberry. Acta Hortic. 2002, 585, 413–416. [Google Scholar] [CrossRef]
- Anikina, I.; Kamarova, A.; Issayeva, K.; Issakhanova, S.; Mustafayeva, N.; Insebayeva, M.; Mukhamedzhanova, A.; Khan, S.M.; Ahmad, Z.; Lho, L.H.; et al. Plant protection from virus: A review of different approaches. Front. Plant Sci. 2023, 12, 1163270. [Google Scholar] [CrossRef] [PubMed] [PubMed Central]
- Zhao, L.; Wang, M.R.; Cui, Z.H.; Chen, L.; Volk, G.M.; Wang, Q.C. Combining thermotherapy with cryotherapy for efficient eradication of apple stem grooving virus from infected in-vitro-cultured apple shoots. Plant Dis. 2018, 102, 1574–1580. [Google Scholar] [CrossRef]
- Hu, G.; Dong, Y.; Zhang, Z.; Fan, X.; Ren, F.; Zhou, J. Virus elimination from in vitro apple by thermotherapy combined with chemotherapy. Plant Cell Tissue Organ Cult. 2015, 121, 435–443. [Google Scholar] [CrossRef]
- Hu, G.J.; Hong, N.; Wang, L.P.; Hu, H.J.; Wang, G.P. Efficacy of virus elimination from in vitro-cultured sand pear (Pyrus pyrifolia) by chemotherapy combined with thermotherapy. Crop Prot. 2012, 37, 20–25. [Google Scholar] [CrossRef]
- Hu, G.; Dong, Y.; Zhang, Z.; Fan, X.; Ren, F. Efficiency of chemotherapy combined with thermotherapy for eliminating Grapevine Leafroll-associated virus 3 (GLRaV-3). Sci. Hortic. 2020, 271, 109462. [Google Scholar] [CrossRef]
- Kaya, E. Comparison of three different techniques for eradication of Apple mosaic virus (ApMV) from hazelnut (Corylus avellana L.). J. Plant Prot. Res. 2021, 61, 11–19. [Google Scholar] [CrossRef]
- Farhadi-Tooli, S.; Ghanbari, A.; Kermani, M.J.; Zeinalabedini, M.; Bettoni, J.C.; Naji, A.M.; Kazemi, N. Droplet-vitrification cryotherapy and thermotherapy as efficient tools for the eradication of apple chlorotic leaf spot virus and apple stem grooving virus from virus-infected quince in vitro cultures. Eur. J. Plant Pathol. 2022, 162, 31–43. [Google Scholar] [CrossRef]
- Raj, R.; Kaur, C.; Agrawal, L.; Kumar, S.; Chauhan, P.S.; Raj, S.K. Development of a protocol for the elimination of Cyrtanthus Elatus virus A from Narcissus Tazetta by in vitro chemotherapy in combination with electrotherapy. J. Virol. Methods 2022, 300, 114368. [Google Scholar] [CrossRef]
- Wang, Q.; Cuellar, W.J.; Rajamäki, M.L.; Hirata, Y.; Valkonen, J.P. Combined thermotherapy and cryotherapy for efficient virus eradication: Relation of virus distribution, subcellular changes, cell survival and viral RNA degradation in shoot tips. Mol. Plant Pathol. 2008, 9, 237–250. [Google Scholar] [CrossRef]
- Mathew, L.; Tiffin, H.; Erridge, Z.; McLachlan, A.; Hunter, D.; Pathirana, R. Efficiency of eradication of raspberry bushy dwarf virus from infected raspberry (Rubus idaeus) by in vitro chemotherapy, thermotherapy and cryotherapy and their combinations. Plant Cell Tissue Organ Cult. 2021, 144, 133–141. [Google Scholar] [CrossRef]
- Theiler-Hedtrich, R.; Baumann, G. Elimination of Apple mosaic virus and raspberry bushy dwarf virus from infected red raspberry (Rubus idaeus L.) by tissue culture. J. Phytopathol. 1989, 127, 193–199. [Google Scholar] [CrossRef]
- Lankes, C. Elimination of raspberry bushy dwarf virus. Acta Hortic. 1995, 385, 70–75. [Google Scholar] [CrossRef]
- Karesova, R.; Janeckova, M.; Paprstein, F. Elimination of raspberry bushy dwarf virus from raspberry CV. ‘Gatineau’. Acta Hortic. 2002, 585, 359–362. [Google Scholar] [CrossRef]
- Zhang, A.L.; Bettoni, J.C.; Shi, X.; Liu, Y.; Yang, B.; Liu, Z. In vitro chemotherapy-based methods for virus elimination from Actinidia macrosperma. Sci. Hortic. 2024, 337, 113543. [Google Scholar] [CrossRef]
- Bettoni, J.C.; Fazio, G.; Carvalho Costa, L.; Hurtado-Gonzales, O.P.; Rwahnih, M.A.; Nedrow, A.; Volk, G.M. Thermotherapy Followed by Shoot Tip Cryotherapy Eradicates Latent Viruses and Apple Hammerhead Viroid from In Vitro Apple Rootstocks. Plants 2022, 11, 582. [Google Scholar] [CrossRef]
- Sánchez-Navarro, J.A.; Aparicio, F.; Herranz, M.C.; Minafra, A.; Myrta, A.; Pallás, V. Simultaneous detection and identification of eight stone fruit viruses by one-step RT-PCR. Eur. J. Plant Pathol. 2005, 111, 77–84. [Google Scholar] [CrossRef]
- Dawson, W.O.; Lozoya-Saldana, H. Examination of the mode of action of Ribavirin Against Tobacco Mosaic virus. Intervirology 1984, 22, 77–84. [Google Scholar] [CrossRef]
- Hauptmanová, A.; Polák, J. The elimination of Plum Pox virus in Plum cv. Bluefree and Apricot CV. Hanita by chemotherapy of in vitro cultures. Hortic. Sci. 2011, 38, 49–53. [Google Scholar] [CrossRef]
- Koubouris, G.C.; Maliogka, V.I.; Efthimiou, K.; Katis, N.I.; Vasilakakis, M.D. Elimination of plum pox virus through in vitro thermotherapy and shoot tip culture compared to conventional heat treatment in apricot cultivar Bebecou. J. Gen. Plant Pathol. 2007, 73, 370–373. [Google Scholar] [CrossRef]
- Gong, H.; Igiraneza, C.; Dusengemungu, L. Major in vitro techniques for potato virus elimination and post eradication detection methods. A Review. Am. J. Potato Res. 2019, 96, 379–389. [Google Scholar] [CrossRef]
- Brison, M.; Boucaud, M.T.; Pierronnet, A.; Dosba, F. Effect of cryopreservation on the sanitary state of a cv. Prunus rootstock experimentally contaminated with Plum pox potyvirus. Plant Sci. 1997, 123, 189–196. [Google Scholar] [CrossRef]
- Souza, J.A.; Bogo, A.; Bettoni, J.C.; Dalla Costa, M.; da Silva, F.N.; Casa, R.T.; Rufato, L. Droplet-vitrification cryotherapy for eradication of Apple stem grooving virus and apple stem pitting virus from “Marubakaido” apple rootstock. Trop. Plant Pathol. 2020, 45, 148–152. [Google Scholar] [CrossRef]
- El-Homosany, A.A.; Noor El-Deen, T.M. In vitro storage of Paulownia tomentosa. Sci. J. Flower Ornam. Plants 2019, 6, 139–149. [Google Scholar] [CrossRef]
- Bettoni, J.C.; Wang, M.R.; Li, J.W.; Fan, X.; Fazio, G.; Hurtado-Gonzales, O.P.; Volk, G.N.; Wang, C.-Q. Application of biotechniques for in vitro virus and viroid elimination in pome fruit crops. Phytopathology 2024, 114, 930–954. [Google Scholar] [CrossRef]
- Wang, M.R.; Bi, W.-L.; Bettoni, J.C.; Zhang, D.; Volk, G.M.; Wang, Q.-C. Shoot tip cryotherapy for plant pathogen eradication. Plant Pathol. 2022, 71, 1241–1254. [Google Scholar] [CrossRef]
- Murashige, T.; Skoog, F. A Revised Medium for Rapid Growth and Bioassays with Tobacco Tissue Cultures. Physiol. Plant. 1962, 15, 473–497. [Google Scholar] [CrossRef]
Treatment | Ribavirin Dose (mg/L) | No. of Cultured Plants | No. of Surviving Plants | Survival Rate (%) |
---|---|---|---|---|
Ch | 0 | 60 | 45 | 75 ab* |
10 | 60 | 41 | 68.3 c | |
20 | 60 | 35 | 58.3 cd | |
30 | 60 | 36 | 60 cd | |
Ch + Th1st | 0 | 36 | 28 | 77.8 ab |
10 | 36 | 25 | 69.4 bc | |
20 | 36 | 27 | 75 ab | |
30 | 36 | 25 | 69.4 bc | |
Th2nd + Ch | 0 | 36 | 35 | 97.2 ab |
10 | 36 | 36 | 100 a | |
20 | 36 | 36 | 100 a | |
30 | 36 | 36 | 100 a | |
Ch + PVS2 | 0 | 36 | 30 | 83.3 ab |
10 | 36 | 20 | 55.6 cd | |
20 | 36 | 24 | 66.7 c | |
30 | 36 | 25 | 69.4 bc | |
Cr | 0 | 36 | 12 | 33.3 d |
Treatment | Ribavirin Dose (mg/L) | No. of Tested Plants | No. of Virus-Free Plants | Elimination Efficiency (%) |
---|---|---|---|---|
Ch | 0 | 9 | 0 | 0 |
10 | 7 | 0 | 0 | |
20 | 10 | 2 | 20 | |
30 | 9 | 3 | 33.3 | |
Ch + Th1st | 0 | 9 | 0 | 0 |
10 | 9 | 0 | 0 | |
20 | 10 | 3 | 30 | |
30 | 10 | 5 | 50 | |
Th2nd + Ch | 0 | 10 | 1 | 10 |
10 | 10 | 2 | 20 | |
20 | 10 | 2 | 20 | |
30 | 10 | 2 | 20 | |
Ch + PVS2 | 0 | 10 | 0 | 0 |
10 | 10 | 0 | 0 | |
20 | 10 | 0 | 0 | |
30 | 10 | 0 | 0 | |
Cr | 0 | 10 | 0 | 0 |
Target | Primer | Sequence | Amplicon Size (bp) | Reference |
---|---|---|---|---|
Control | rbcL a | CTGCATGCATTGCACGGTG TACTTGAACGCTACTGCAG | 186 | [41] |
rbcL s | ||||
BMIV | 79F | CGGACTTTGTTGTTTGGAGTT CACCACTCTAATGGGGAAATG | 282 | [15] |
361R | ||||
362F | AAAAGAATGGGTTTAATAGCTCA TCATGTCTTCATCAGACAATTT | 654 | ||
1016R | ||||
458F | TTGGATTGCGTCGGTGGTGGTTC TCATGTCTTCATCAGACAATTT | 558 | ||
1016R | ||||
821F | TACGGTTGCTCCGTTTTCTCT GAAACAAACCGGTTTCAC | 1295 | ||
2116R | ||||
1567F | GGTTCATTCCGGTTATGATTT | 549 | ||
2116R | GAAACAAACCGGTTTCAC | |||
1567F | GGTTCATTCCGGTTATGATTT CGTTTTCCAGAACAGTCATTTTT | 946 | ||
2513R | ||||
1611F | GAATGGTCCAGCACGAAGTAA TCGAAGAAAACTGAGTCGTCA | 982 | ||
2583R | ||||
3863F | GAAGCTAGTAAGTCCGAAGCTTCG | 427 | ||
4290R | ACTTGCCTGCTGCTAGTATTTCTTCT |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Abdelwahab Elansary, D.W.; Gürcan, K.; Roumi, V.; Şimşek, Ö. Efficacy of Plant Tissue Culture Techniques for Eliminating Black Mulberry Idaeovirus (BMIV) from Infected Black Mulberry (Morus nigra). Plants 2024, 13, 2959. https://doi.org/10.3390/plants13212959
Abdelwahab Elansary DW, Gürcan K, Roumi V, Şimşek Ö. Efficacy of Plant Tissue Culture Techniques for Eliminating Black Mulberry Idaeovirus (BMIV) from Infected Black Mulberry (Morus nigra). Plants. 2024; 13(21):2959. https://doi.org/10.3390/plants13212959
Chicago/Turabian StyleAbdelwahab Elansary, Doaa Waseem, Kahraman Gürcan, Vahid Roumi, and Özhan Şimşek. 2024. "Efficacy of Plant Tissue Culture Techniques for Eliminating Black Mulberry Idaeovirus (BMIV) from Infected Black Mulberry (Morus nigra)" Plants 13, no. 21: 2959. https://doi.org/10.3390/plants13212959
APA StyleAbdelwahab Elansary, D. W., Gürcan, K., Roumi, V., & Şimşek, Ö. (2024). Efficacy of Plant Tissue Culture Techniques for Eliminating Black Mulberry Idaeovirus (BMIV) from Infected Black Mulberry (Morus nigra). Plants, 13(21), 2959. https://doi.org/10.3390/plants13212959