Results 21 to 30 of about 41,410 (250)
Scientific Reports, 2021 The short and similar sized chromosomes of Acropora pose a challenge for karyotyping. Conventional methods, such as staining of heterochromatic regions, provide unclear banding patterns that hamper identification of such chromosomes.
Joshua Vacarizas +6 more
doaj +1 more source
Parasites & Vectors, 2023 Background Trypanosomes are single-celled eukaryotes that rely heavily on post-transcriptional mechanisms to regulate gene expression. RNA-binding proteins play essential roles in regulating the fate, abundance and translation of messenger RNAs (mRNAs ...
Gloria Ceballos-Pérez +3 more
doaj +1 more source
The long-range interaction map of ribosomal DNA arrays. [PDF]
PLoS Genetics, 2018 The repeated rDNA array gives rise to the nucleolus, an organelle that is central to cellular processes as varied as stress response, cell cycle regulation, RNA modification, cell metabolism, and genome stability.
Shoukai Yu, Bernardo Lemos
doaj +1 more source
Amplification and adaptation of centromeric repeats in polyploid switchgrass species. [PDF]
, 2018 Centromeres in most higher eukaryotes are composed of long arrays of satellite repeats from a single satellite repeat family. Why centromeres are dominated by a single satellite repeat and how the satellite repeats originate and evolve are among the most
Braz, Guilherme T +10 more
core +2 more sources
Quantitative Expression of RNA from Frozen Organs and Formaldehyde-fixed and Paraffin-embedded Tissues#br# [PDF]
Fayixue Zazhi, 2019 Objective Quantitative analysis and comparison of the expression of ribonucleic acid （RNA） from frozen organs and formaldehyde-fixed and paraffin-embedded （FFPE） tissues.
Lü Ye-hui, LI Shi-ying, LI Zhi-hong，et al
doaj +1 more source
BMC Ecology and Evolution, 2021 Background Autotetraploid Carassius auratus (4n = 200, RRRR) (abbreviated as 4nRR) is derived from whole genome duplication of Carassius auratus red var. (2n = 100, RR) (abbreviated as RCC).
Chun Zhao +10 more
doaj +1 more source
Two thraustochytrid 5S ribosomal RNAs
Nucleic Acids Research, 1982 The complete nucleotide sequences of the 5S ribosomal RNAs (rRNAs) of two thraustochytrids, Thraustochytrium visurgense and Schizochytrium, aggregatum, are AUGAGCCCUCAUAUCAUGUGGAGUGCACCGGAUCUCAUCCGAACUCCGUAGUUAAGCCACAUAGAGCGCGUC UAGUACUGCCGUAGGGGACUAGGUGGGAAGCACGCGUGGGGCUCAUU and ACAGCCGUUCAUACCACACGGAGA ...
R M, MacKay, W F, Doolittle
openaire +3 more sources
Early evolutionary colocalization of the nuclear ribosomal 5S and 45S gene families in seed plants: evidence from the living fossil gymnosperm Ginkgo biloba [PDF]
, 2012 In seed plants, the colocalization of the 5S loci within the intergenic spacer (IGS) of the nuclear 45S tandem units is restricted to the phylogenetically derived Asteraceae family. However, fluorescent in situ hybridization (FISH) colocalization of both
Galián, José A. +2 more
core +1 more source
Nucleic Acids Research, 1999 This paper presents the updated version of the data base of ribosomal 5S ribonucleic acids (5S rRNA) and their genes (5S rDNA). This edition of the data bank contains 1889 primary structures of 5S rRNA and 5S rDNA. These include 60 archaebacterial, 439 eubacterial, 63 plastid, 9 mitochondrial and 1318 eukaryotic sequences.
M, Szymanski +3 more
openaire +3 more sources
Haematologica, 2010 Background Diamond-Blackfan anemia and Shwachman-Diamond syndrome are inherited bone marrow failure syndromes linked to defects in ribosome synthesis.
Joseph B. Moore +4 more
doaj +1 more source