Results 31 to 40 of about 86,120 (307)
Quantitative Expression of RNA from Frozen Organs and Formaldehyde-fixed and Paraffin-embedded Tissues#br# [PDF]
Fayixue Zazhi, 2019 Objective Quantitative analysis and comparison of the expression of ribonucleic acid （RNA） from frozen organs and formaldehyde-fixed and paraffin-embedded （FFPE） tissues.
Lü Ye-hui, LI Shi-ying, LI Zhi-hong，et al
doaj +1 more source
Early evolutionary colocalization of the nuclear ribosomal 5S and 45S gene families in seed plants: evidence from the living fossil gymnosperm Ginkgo biloba [PDF]
, 2012 In seed plants, the colocalization of the 5S loci within the intergenic spacer (IGS) of the nuclear 45S tandem units is restricted to the phylogenetically derived Asteraceae family. However, fluorescent in situ hybridization (FISH) colocalization of both
Galián, José A. +2 more
core +1 more source
Expansion segments in bacterial and archaeal 5S ribosomal RNAs [PDF]
RNA, 2020 The large ribosomal RNAs of eukaryotes frequently contain expansion sequences that add to the size of the rRNAs but do not affect their overall structural layout and are compatible with major ribosomal function as an mRNA translation machine. The expansion of prokaryotic ribosomal RNAs is much less explored.
Victor G. Stepanov, George E. Fox
openaire +4 more sources
BMC Ecology and Evolution, 2021 Background Autotetraploid Carassius auratus (4n = 200, RRRR) (abbreviated as 4nRR) is derived from whole genome duplication of Carassius auratus red var. (2n = 100, RR) (abbreviated as RCC).
Chun Zhao +10 more
doaj +1 more source
Two thraustochytrid 5S ribosomal RNAs
Nucleic Acids Research, 1982 The complete nucleotide sequences of the 5S ribosomal RNAs (rRNAs) of two thraustochytrids, Thraustochytrium visurgense and Schizochytrium, aggregatum, are AUGAGCCCUCAUAUCAUGUGGAGUGCACCGGAUCUCAUCCGAACUCCGUAGUUAAGCCACAUAGAGCGCGUC UAGUACUGCCGUAGGGGACUAGGUGGGAAGCACGCGUGGGGCUCAUU and ACAGCCGUUCAUACCACACGGAGA ...
W. Ford Doolittle, Ron M. MacKay
openaire +4 more sources
Nucleic Acids Research, 1999 This paper presents the updated version of the data base of ribosomal 5S ribonucleic acids (5S rRNA) and their genes (5S rDNA). This edition of the data bank contains 1889 primary structures of 5S rRNA and 5S rDNA. These include 60 archaebacterial, 439 eubacterial, 63 plastid, 9 mitochondrial and 1318 eukaryotic sequences.
Maciej Szymanski +3 more
openaire +4 more sources
Haematologica, 2010 Background Diamond-Blackfan anemia and Shwachman-Diamond syndrome are inherited bone marrow failure syndromes linked to defects in ribosome synthesis.
Joseph B. Moore +4 more
doaj +1 more source
SSB-1 of the yeast Saccharomyces cerevisiae is a nucleolar-specific, silver-binding protein that is associated with the snR10 and snR11 small nuclear RNAs [PDF]
, 1990 SSB-1, the yeast single-strand RNA-binding protein, is demonstrated to be a yeast nucleolar-specific, silver-binding protein. In double-label immunofluorescence microscopy experiments antibodies to two other nucleolar proteins, RNA Pol I 190-kD and ...
Abelson, John +3 more
core +2 more sources
Purification of 70S Ribosomes from Bacillus subtilis
Bio-Protocol, 2015 The eubacterial ribosome (70S) is a macromolecular complex that is composed of a small (30S) subunit and a large (50S) subunit. The small subunit comprises the 16S ribosomal RNA (rRNA) and more than 20 ribosomal proteins (r-proteins), whereas the large ...
Shota Suzuki +2 more
doaj +1 more source
Transcriptionally inactive oocyte-type 5S RNA genes of Xenopus laevis are complexed with TFIIIA in vitro [PDF]
, 1987 An extract from whole oocytes of Xenopus laevis was shown to transcribe somatic-type 5S RNA genes approximately 100-fold more efficiently than oocyte-type 5S RNA genes.
Eversole-Cire, Pamela +4 more
core +1 more source