Results 81 to 90 of about 86,120 (307)
Comparative Cytogenetics, 2011 The fluorescent in situ hybridization (FISH) technique has been applied to somatic chromosomes in the medicinally important species, Bunium persicum, to elucidate its karyotypes.
R. K. Chahota +4 more
doaj +1 more source
Nuclear RNA Surveillance in \u3cem\u3eSaccharomyces cerevisiae\u3c/em\u3e: Trf4p-dependent Polyadenylation of Nascent Hypomethylated tRNA and an Aberrant Form of 5S rRNA [PDF]
, 2006 1-Methyladenosine modification at position 58 of tRNA is catalyzed by a two-subunit methyltransferase composed of Trm6p and Trm61p in Saccharomyces cerevisiae.
Anderson, James T. +2 more
core +1 more source
BioEssays, EarlyView.The Role of Ribosome Recycling in Human Diseases This diagram highlights how disruptions in ribosome translation and recycling can negatively impact cellular and organismal health. Usually, these processes operate efficiently to maintain cellular protein homeostasis.
Foozhan Tahmasebinia, Zhihao Wu
wiley +1 more source
The sequence of the 5S ribosomal RNA of the crustacean Artemia salina [PDF]
Nucleic Acids Research, 1981 The primary structure of the 5 S rRNA isolated from the cryptobiotic cysts of the brine shrimp Artemia salina is pACCAACGGCCAUACCACGUUGAAAGUACCCAGUCUCGUCAGAUCCUGGAAGUCACACAACGUCGGGCCCGGUCAGUACUUGGAUGGGUGACCGCCUGGGAACACCGGGUGCUGUUGGCAU (OH).
Rupert De Wachter +3 more
openaire +3 more sources
RNA Polymerase III Subunit Mutations in Genetic Diseases
Frontiers in Molecular Biosciences, 2021 RNA polymerase (Pol) III transcribes small untranslated RNAs such as 5S ribosomal RNA, transfer RNAs, and U6 small nuclear RNA. Because of the functions of these RNAs, Pol III transcription is best known for its essential contribution to RNA maturation ...
Elisabeth Lata +7 more
doaj +1 more source
Taxonomic studies on methylotrophic bacteria by 5S ribosomal RNA sequencing.
Journal of General Microbiology, 1990 Nucleotide sequences of 5S ribosomal RNA (rRNA) isolated from 19 strains of Gram-negative methylotrophic bacteria were determined. Comparison of these sequences allowed construction of a tentative phylogenetic tree and showed that the bacteria analysed ...
E. S. Bulygina +6 more
semanticscholar +1 more source
Molecular cytogenetic differentiation of paralogs of Hox paralogs in duplicated and re-diploidized genome of the North American paddlefish (Polyodon spathula). [PDF]
, 2017 BackgroundAcipenseriformes is a basal lineage of ray-finned fishes and comprise 27 extant species of sturgeons and paddlefishes. They are characterized by several specific genomic features as broad ploidy variation, high chromosome numbers, presence of ...
Amemiya, Chris T +7 more
core +4 more sources
Extraocular Photoreception in Optic Lobes, Suckers, and Skin of Octopus vulgaris
Integrative Zoology, EarlyView.Evidence of extra‐ocular photoreception in Octopus vulgaris (a) Diagram of the O. vulgaris different tissues considered: SPB, sucker proximal big; SPL, sucker proximal large; SM, sucker medium; SD, sucker distal; SK, skin; OL, optic lobes; RT, retina; (b‐d) Gene expression analysis of Ov‐GRK1 (red), Ov‐retinochrome (green), Ov‐rhodopsin (blue) mRNA ...
Valeria Maselli +7 more
wiley +1 more source
Evolutionary dynamics of rRNA gene clusters in cichlid fish
BMC Evolutionary Biology, 2012 Background Among multigene families, ribosomal RNA (rRNA) genes are the most frequently studied and have been explored as cytogenetic markers to study the evolutionary history of karyotypes among animals and plants. In this report, we applied cytogenetic
Nakajima Rafael T +4 more
doaj +1 more source
Molecular Ecology, EarlyView.ABSTRACT DNA within the nucleus is organised into a well‐regulated three‐dimensional (3D) structure. However, how such 3D genome structures influence speciation processes remains largely elusive. Recent studies have shown that 3D genome structures influence mutation rates, including the occurrence of chromosomal rearrangement.
Yo Y. Yamasaki +4 more
wiley +1 more source