Results 51 to 60 of about 204,221 (349)

A genetic association study of glutamine-encoding DNA sequence structures, somatic CAG expansion, and DNA repair gene variants, with Huntington disease clinical outcomes

EBioMedicine, 2019
Background Huntington disease (HD) is caused by an unstable CAG/CAA repeat expansion encoding a toxic polyglutamine tract. Here, we tested the hypotheses that HD outcomes are impacted by somatic expansion of, and polymorphisms within, the HTT CAG/CAA ...
Marc Ciosi, Alastair Maxwell, S. Cumming, Davina J. Hensman Moss, A. M. Alshammari, M. Flower, A. Durr, B. Leavitt, R. Roos, The Enroll-HD Team, The Enroll-HD Team, P. Holmans, L. Jones, D. Langbehn, Seung Kwak, S. Tabrizi, D. Monckton   +16 more
semanticscholar   +1 more source

ATXN2-CAG42 sequesters PABPC1 into insolubility and induces FBXW8 in cerebellum of old ataxic knock-in mice [PDF]

, 2012
Spinocerebellar Ataxia Type 2 (SCA2) is caused by expansion of a polyglutamine encoding triplet repeat in the human ATXN2 gene beyond (CAG)31. This is thought to mediate toxic gain-of-function by protein aggregation and to affect RNA processing ...
Damrath, Ewa, Joachim Nowock (139049), Azizov, Mekhman, Seifried, Carola, Nowock, Joachim, Rüb, Udo, Suzana Gispert (139045), Udo Rüb (139053), Mekhman Azizov (139047), Auburger, Georg, Mekhman Azizov, Joachim Nowock, Melanie V. Heck (139043), Michael Walter (139055), Walter, Michael, Carola Seifried, Gispert, Suzana, Carola Seifried (139051), Heck, Melanie V., Suzana Gispert, Georg Auburger (139057), Michael Walter, Georg Auburger, Melanie V Heck, Udo Rüb, Ewa Damrath, Ewa Damrath (139041)   +26 more
core   +1 more source

The Helicobacter pylori cag pathogenicity island as a determinant of gastric cancer risk

Gut microbes
Helicobacter pylori strains can be broadly classified into two groups based on whether they contain or lack a chromosomal region known as the cag pathogenicity island (cag PAI).
Sirena C. Tran, Kaeli N. Bryant, T. Cover   +2 more
semanticscholar   +1 more source

Partial depletion of plasminogen activator inhibitor‐1 decreases subcutaneous fat cell hypertrophy and liver cholesterol in high‐fat‐fed female mice

FEBS Letters, EarlyView.
Obesity raises blood levels of PAI‐1, a protein linked to metabolic dysfunction‐associated steatotic liver disease in people with obesity. In female mice fed a high‐fat diet, partially lowering PAI‐1 led to smaller subcutaneous fat cells and lower liver cholesterol, without changing body weight or insulin sensitivity.
Claudia E. Ramirez Bustamante, Robert Sharp, Pradip K. Saha, Elizabeth S. Anaya, Elizabeth L. Lieu, Evelyn L. de Groot, Pooja Patel, Mi Jeong Heo, Aaron R. Cox, Kang Ho Kim, Sean M. Hartig   +10 more
wiley   +1 more source

Canadian Association of Gastroenterology Policy on the Application for, and Implementation of, Clinical Practice Guidelines

Canadian Journal of Gastroenterology and Hepatology, 2014
An important mandate of the Canadian Association of Gastroenterology (CAG), as documented in the Association’s governance policies, is to optimize the care of patients with digestive disorders. Clinical practice guidelines are one means of achieving this
Harminder Singh, Grigorios I Leontiadis, Lawrence Hookey, Robert Enns, Lana Bistritz, Louis-Charles Rioux, Louise Hope, Paul Sinclair   +7 more
doaj   +1 more source

Splice modulators target PMS1 to reduce somatic expansion of the Huntington’s disease-associated CAG repeat

Nature Communications
Huntington’s disease (HD) is a dominant neurological disorder caused by an expanded HTT exon 1 CAG repeat that lengthens huntingtin’s polyglutamine tract.
Zachariah L McLean, D. Gao, Kevin Correia, Jennie C. L. Roy, S. Shibata, Iris N. Farnum, Zoe Valdepenas-Mellor, Marina Kovalenko, Manasa Rapuru, Elisabetta Morini, Jayla Ruliera, T. Gillis, D. Lucente, B. Kleinstiver, Jong-Min Lee, M. MacDonald, V. Wheeler, Ricardo Mouro Pinto, J. Gusella   +18 more
semanticscholar   +1 more source

Absence of Venus transcript in SB-CAG-VENUS spermatozoa.

, 2016
The following primer pairs were used in RT-PCR experiments: Fig 4A: YFP Venus specific primer:Forward: 5’ GGTCCCTCTTCTCGTTAGGG 3’ Reverse: 5’ TACAAGACCAGAGCCGAGGT 3’ Fig 4B: neonatal rabbit Fc receptor specific primer [19]; Fig 4C: ribosomal 28S subunit ...
Sabine Klein (196104), Zoltan Ivics (2697694), Szilard Bodo (2697682), Nandor Lipták (2697688), Andrea Kerekes (335556), Wilfried A. Kues (196140), Laszlo Hiripi (2697700), Gabor Szaloki (2697685), Orsolya I. Hoffmann (2697697), Zsuzsanna Bosze (2697691)   +9 more
core   +1 more source

Bovine proteins containing poly-glutamine repeats are often polymorphic and enriched for components of transcriptional regulatory complexes [PDF]

, 2010
peer-reviewedBackground: About forty human diseases are caused by repeat instability mutations. A distinct subset of these diseases is the result of extreme expansions of polymorphic trinucleotide repeats; typically CAG repeats encoding poly-glutamine ...
Herman Raadsma, Raadsma Herman, Lynn David J, Hobbs, Matthew, Whan Vicki, McWilliam, Sean, Lynn, David J, Tellam, Ross L, Barendse William, Tellam Ross L, Ross L Tellam, Vicki Whan, McWilliam Sean, Khatkar Mehar, Lutzow Ylva, David J Lynn, William Barendse, Ylva Lutzow, Whan, Vicki, Khatkar, Mehar, Raadsma, Herman, Tellam, Ross L., Ylva Strandberg Lutzow, Barendse, William, Lutzow, Ylva Strandberg, Sean McWilliam, Lynn, David J., Lutzow, Ylva S, Matthew Hobbs, Hobbs Matthew, Mehar Khatkar   +30 more
core   +1 more source

Inhibition of cyclin‐dependent kinases 12/13 using CT7439 as a treatment for colorectal cancer with CDK12 upregulation

Molecular Oncology, EarlyView.
The proposed mechanism of action for the CDK12/13 inhibitor and cyclin K degrader, CT7439. CDK12/13 inhibition interrupts transcription elongation, leading to increased DNA damage that results in cell death. This agent is a potentially novel treatment option for patients with colorectal cancer. Created in BioRender. Cyclin‐dependent kinase (CDK) 12 and
Wylie K. Watlington, Divya L. Dayanidhi, Mohammad Zokaasadi, John B. Mantyh, Pelumi D. Olawuni, Gabrielle Rupprecht, Jeremy M. Force, Shannon McCall, Ashwani K. Bahl, David S. Hsu, Jason A. Somarelli   +10 more
wiley   +1 more source

Epigenetic silencing of the liver‐specific lncRNA LUNAR promotes liver cancer progression via NOTCH activation

Molecular Oncology, EarlyView.
LUNAR is a liver‐specific long noncoding RNA (lncRNA) that is highly expressed in normal liver but becomes epigenetically silenced in hepatocellular carcinoma through promoter hypermethylation. Loss of LUNAR is associated with NOTCH activation, epithelial–mesenchymal transition, and metastasis, whereas restoring LUNAR restrains metastatic progression ...
Se Ha Jang, Hyung Seok Kim, Geum Ok Baek, Moon Gyeong Yoon, Su In Lee, Jee‐Yeong Jeong, Ji Eun Han, Soon Sun Kim, Jae Youn Cheong, Jung Woo Eun   +9 more
wiley   +1 more source