Results 71 to 80 of about 576 (168)

Survey of Prunus necrotic ringspot virus in rose and its variability in rose and Prunus spp

, 2001
International audienceA survey for viruses in rose propagated in Europe resulted in detection of only Prunus necrotic ringspot virus (PNRSV) among seven viruses screened.
Poupet, Alain, Moury, Benoît, Cardin, Loïc, Candresse, Thierry,, Candresse, Thierry, Onesto, Jean-Paul   +5 more
core   +1 more source

Studies on parameters influencing the performance of reverse transcriptase polymerase chain reaction (RT-PCR) in detecting Prunus necrotic ringpot virus (PNRSV)

, 2005
In order to have a more detailed understanding of the various factors influencing a reverse transcriptasepolymerase chain reaction (RT-PCR), a number of important parameters such as Mg+2, primer, enzyme concentration and others were optimized for ...
Sıpahıoglu, Hikmet Murat, Usta, Mustafa, Polat, Bulent   +2 more
core  

Обследвания и проучване на Ilar вируси в свободно растящата популация от махалебкови форми и диви череши в района на Кюстендил

Растениевъдни науки, 2021
В Кюстендилския район в резултат на дългогодишен практически и научен опит, махалебката (Prunus mahaleb L.) и дивата череша (Prunus avium L.) са се утвърдили, като основни подложки при черешата и вишната.
Симеон Крумов, Анелия Борисова, Иванка Каменова   +2 more
doaj  

Comparison of ELISA and RT-PCR for the detection of PNRSV and PDV in Australian almond trees

, 2003
This three-year study compared the use of ELISA and RT-PCR for identifying Prunus necrotic ringspot virus (PNRSV) and prune dwarf virus (PDV) on 175 leaf samples taken from trees maintained as a budwood repository for almond growers. The primers used for
Collins, G., Wirthensohn, M., Mekuria, G., Alberts, E., Sedgley, M., Ramesh, S., Bertozzi, T.   +6 more
core  

Rose Virome Analysis and Identification of a Novel Ilarvirus in Taiwan. [PDF]

Viruses, 2022
Chen TC, Lin YC, Lin CC, Lin YX, Chen YK.   +4 more
europepmc   +1 more source

Rapid Detection of Prunus Necrotic Ringspot Virus by Reverse Transcription-cross-priming Amplification Coupled with Nucleic Acid Test Strip Cassette

, 2017
Prunus necrotic ringspot virus (PNRSV) is one of the most devastating viruses to Prunus spp. In this study, we developed a diagnostic system RT-CPA-NATSC, wherein reverse transcription-cross-priming amplification (RT-CPA) is coupled with nucleic acid ...
Ya-Yun Huo, Wei-Min Li, Yong-Jiang Zhang, Yan-Hong Qiu, Gui-Fen Li   +4 more
core   +1 more source

The Roles of N6-Methyladenosine Modification in Plant-RNA Virus Interactions. [PDF]

Int J Mol Sci, 2023
He M, Li Z, Xie X.
europepmc   +1 more source

DEVELOPMENT OF DIAGNOSTIC KIT AGAINST THE RECOMBINANT COAT PROTEIN OF PRUNUS NECROTIC RINGSPOT VIRUS.

, 2010
1. Primers useful for detection of Prunus necrotic ringspot virus (PNRSV) in plants, comprising the following sequence: Sequence ID 1: upstream primer AACTGCAGATGGTTTGCCGAATTTGCAA Sequence ID 2: downstream primer GCTCTAGACTAGATCTCAAGCAGGTC 2.
Hallan, Vipin, Raikhy, G, Zaidi, A A, Kulshrestha, S   +3 more
core  

Two interacting ethylene response factors negatively regulate peach resistance to Lasiodiplodia theobromae. [PDF]

Plant Physiol, 2023
Zhang D, Zhu K, Shen X, Meng J, Huang X, Tan Y, Cardinale F, Liu J, Li G, Liu J.   +9 more
europepmc   +1 more source

Recognition of cis-acting sequences in RNA 3 of Prunus necrotic ringspot virus by the replicase of Alfalfa mosaic virus

, 2001
Alfalfa mosaic virus (AMV) and Prunus necrotic ring-spot virus (PNRSV) belong to the genera Alfamo-virus and Ilarvirus, respectively, of the family Bromoviridae. Initiation of infection by AMV and PNRSV requires binding of a few molecules of coat protein
V. Palla S, J. F. Bol, Aparicio, F., F. Aparicio, R. C. L. Olsthoorn, Olsthoorn, R.R.C.L., Bol, J.F., Sanchez-Navarro, J.A., J. A. Sa Nchez-navarro, Pallas, V.   +9 more
core   +1 more source