Results 111 to 120 of about 14,795 (267)
Chemistry – A European Journal, Volume 31, Issue 72, December 23, 2025.The REG1CP‐derived RNA oligonucleotide SL15P adopts a parallel G‐quadruplex (rGQ) structure. In this study, we investigate the effect of several well‐characterized ligands, originally developed for DNA GQs, on the RNA counterpart, with the aim of evaluating their binding ability and specific binding modes.
Giuseppe Satta +2 more
wiley +1 more source
Tree decomposition and parameterized algorithms for RNA structure-sequence alignment including tertiary interactions and pseudoknots [PDF]
, 2012 We present a general setting for structure-sequence comparison in a large class of RNA structures that unifies and generalizes a number of recent works on specific families on structures.
Barth, Dominique +3 more
core +3 more sources
Nucleic Acids Research, 2018 Telomerase adds telomeric repeats to chromosome ends by processive copying of a template within the telomerase RNA bound to telomerase reverse transcriptase.
A. Deshpande, K. Collins
semanticscholar +1 more source
ChemBioChem, Volume 26, Issue 24, December 11, 2025.A combined virtual and nuclear magnetic resonance (NMR)‐based screening approach identifies small molecules that bind conserved SARS‐CoV‐2 RNA structures. Diverse compound libraries are screened using full‐atom refinement 2‐generated ensembles of stem‐loop 1 and the frameshift pseudoknot. Predicted hits are validated by ligand‐ and target‐detected NMR,
Sabrina Toews +4 more
wiley +1 more source
Fatgraph models of RNA structure
Computational and Mathematical Biophysics, 2017 In this review paper we discuss fatgraphs as a conceptual framework for RNA structures. We discuss various notions of coarse-grained RNA structures and relate them to fatgraphs.We motivate and discuss the main intuition behind the fatgraph model and ...
Huang Fenix +2 more
doaj +1 more source
Structure and folding of the Tetrahymena telomerase RNA pseudoknot
Nucleic Acids Research, 2016 Telomerase maintains telomere length at the ends of linear chromosomes using an integral telomerase RNA (TER) and telomerase reverse transcriptase (TERT).
D. Cash, J. Feigon
semanticscholar +1 more source
Advanced Engineering Materials, Volume 27, Issue 22, November 2025.Molecular dynamics simulations are advancing the study of ribonucleic acid (RNA) and RNA‐conjugated molecules. These developments include improvements in force fields, long‐timescale dynamics, and coarse‐grained models, addressing limitations and refining methods.
Kanchan Yadav, Iksoo Jang, Jong Bum Lee
wiley +1 more source
Conformation of an RNA pseudoknot
Journal of Molecular Biology, 1990 The structure of the 5' GCGAUUUCUGACCGCUUUUUUGUCAG 3' RNA oligonucleotide was investigated using biochemical and chemical probes and nuclear magnetic resonance spectroscopy. Formation of a pseudoknot is indicated by the imino proton spectrum. Imino protons are observed consistent with formation of two helical stem regions; nuclear Overhauser ...
Puglisi, Joseph D. +2 more
openaire +2 more sources
Stacks in canonical RNA pseudoknot structures [PDF]
Mathematical Biosciences, 2009 In this paper we study the distribution of stacks in $k$-noncrossing, $ $-canonical RNA pseudoknot structures ($ $-structures). An RNA structure is called $k$-noncrossing if it has no more than $k-1$ mutually crossing arcs and $ $-canonical if each arc is contained in a stack of length at least $ $.
Han, Hillary S. W., Reidys, Christian M.
openaire +3 more sources