Results 261 to 270 of about 14,400 (274)

Modular Polymerase Synthesis and Internal Protein Domain Swapping via Dual Opposed Frameshifts in the Ebola Virus L Gene. [PDF]

Pathogens
Stubbs DB, Ruzicka JA, Taylor EW.
europepmc   +1 more source

Functional Validation of SAM Riboswitch Element A from <i>Listeria monocytogenes</i>. [PDF]

Biochemistry
Hall I, Zablock K, Sobetski R, Weidmann CA, Keane SC.   +4 more
europepmc   +1 more source

Some of the next articles are maybe not open access.

Related searches:

A non-invasive wearable stress patch for real-time cortisol monitoring using a pseudoknot-assisted aptamer.

Biosensors & bioelectronics, 2023
Stress is part of everyone's life and is exacerbated by traumatic events such as pandemics, disasters, violence, lifestyle changes, and health disorders. Chronic stress has many detrimental health effects and can even be life-threatening.
Naveen K. Singh, Saeromi Chung, An-Yi Chang, Joseph Wang, D. Hall   +4 more
semanticscholar   +1 more source

A pseudoknotted RNA oligonucleotide

Nature, 1988
The diverse functions of RNA, which include enzymatic activities, regulatory roles in transcription and translation, are made possible by tertiary structure. Computer algorithms can predict the secondary structure of an RNA molecule using free-energy parameters for base pairing and stacking, loops and bulges. However, with the exception of transfer RNA,
Jacqueline R. Wyatt, Ignacio Tinoco, Joseph D. Puglisi   +2 more
openaire   +3 more sources

Tertiary Base Triple Formation in the SRV-1 Frameshifting Pseudoknot Stabilizes Secondary Structure Components.

Biochemistry, 2020
Minor-groove base triples formed between stem 1 and loop 2 of the simian retrovirus type 1 (SRV-1) mRNA frameshifting pseudoknot are essential in stimulating -1 ribosomal frameshifting.
Lixia Yang, Desiree-Faye Kaixin Toh, Manchugondanahalli S. Krishna, Zhensheng Zhong, Yiyao Liu, Shaomeng Wang, Y. Gong, Gang Chen   +7 more
semanticscholar   +1 more source

Pseudoknots in RNA Structure Prediction

Current Protocols, 2023
AbstractRNA molecules play active roles in the cell and are important for numerous applications in biotechnology and medicine. The function of an RNA molecule stems from its structure. RNA structure determination is time consuming, challenging, and expensive using experimental methods.
Andrew, Hollar, Hunter, Bursey, Hosna, Jabbari   +2 more
openaire   +2 more sources

RNA pseudoknots

Accounts of Chemical Research, 1990
The effects of ionic conditions, loop size and loop sequence on the formation of pseudoknots by RNA oligonucleotides have been investigated using biochemical and biophysical methods. An oligonucleotide with the sequence 5' GCGAUUUCUGACCGCUUUUUUGUCAG 3' and oligonucleotides with variations in the sequences of the two loop regions, denoted by bold face ...
Jacqueline R. Wyatt, Ignacio Tinoco, Joseph D. Puglisi   +2 more
openaire   +3 more sources

Algorithms for pseudoknot classification

Proceedings of the 2nd ACM Conference on Bioinformatics, Computational Biology and Biomedicine, 2011
The structures of non-coding RNAs are found to be critical in many biological functions. In particular, pseudoknotted structures play an important role in some of these functions. Different pseudoknotted structures may have different functionalities.
Bay-Yuan Hsu, Hui-Ting Yu, Thomas K. F. Wong, Tak-Wah Lam, Siu-Ming Yiu, Wing-Kai Hon   +5 more
openaire   +2 more sources

Aptamer pseudoknot-functionalized electronic sensor for reagentless and single-step detection of immunoglobulin E in human serum.

Analytical Chemistry, 2015
The development of electronic sensors with minimized usage of reagents and washing steps in the sensing protocols will significantly facilitate the detection of biomolecules.
Bingying Jiang, Fang-zhen Li, Cuiyun Yang, Jia‐qing Xie, Yun Xiang, R. Yuan   +5 more
semanticscholar   +1 more source

Structural Alignment of RNAs with Pseudoknots

2011
Non-coding RNAs (ncRNAs) are found to be critical for many biological processes. However, identifying these molecules is very difficult and challenging due to the lack of strong detectable signals such as opening read frames. Most computational approaches rely on the observation that the secondary structures of ncRNA molecules are conserved within the ...
Yiu, SM, Wong, KF
openaire   +4 more sources