Results 21 to 30 of about 14,400 (274)

Gene editing with CRISPR-Cas12a guides possessing ribose-modified pseudoknot handles

Nature Communications, 2021
Development of Cas12a for human therapeutics and diagnostics may significantly benefit from, or even require, chemical modification of its guide RNA. Here the authors show that the noncanonical 5′ pseudoknot structure of the AsCas12a crRNA guide can be ...
Eman A. Ageely, Ramadevi Chilamkurthy, Sunit Jana, Leonora Abdullahu, Daniel O’Reilly, Philip J. Jensik, Masad J. Damha, Keith T. Gagnon   +7 more
doaj   +2 more sources

New models and algorithms for RNA pseudoknot order assignment

International Journal of Applied Mathematics and Computer Science, 2020
The pseudoknot is a specific motif of the RNA structure that highly influences the overall shape and stability of a molecule. It occurs when nucleotides of two disjoint single-stranded fragments of the same chain, separated by a helical fragment ...
Zok Tomasz, Badura Jan, Swat Sylwester, Figurski Kacper, Popenda Mariusz, Antczak Maciej   +5 more
doaj   +2 more sources

SparseRNAfolD: optimized sparse RNA pseudoknot-free folding with dangle consideration [PDF]

Algorithms for Molecular Biology
Motivation Computational RNA secondary structure prediction by free energy minimization is indispensable for analyzing structural RNAs and their interactions.
Mateo Gray, Sebastian Will, Hosna Jabbari   +2 more
doaj   +2 more sources

Combinatorics Of RNA Structures With Pseudoknots [PDF]

arXiv, 2007
In this paper we derive the generating function of RNA structures with pseudoknots. We enumerate all $k$-noncrossing RNA pseudoknot structures categorized by their maximal sets of mutually intersecting arcs. In addition we enumerate pseudoknot structures over circular RNA. For 3-noncrossing RNA structures and RNA secondary structures we present a novel
Jing Qin, Emma Yu Jin, Christian M. Reidys   +2 more
arxiv   +6 more sources

Sequence-structure relations of pseudoknot RNA [PDF]

BMC Bioinformatics, 2009
Background The analysis of sequence-structure relations of RNA is based on a specific notion and folding of RNA structure. The notion of coarse grained structure employed here is that of canonical RNA pseudoknot contact-structures with at most two ...
Li Linda YM, Huang Fenix WD, Reidys Christian M   +2 more
doaj   +4 more sources

Salt Effects on the Thermodynamics of a Frameshifting RNA Pseudoknot under Tension [PDF]

Journal of Molecular Biology, 2016
Because of the potential link between -1 programmed ribosomal frameshifting and response of a pseudoknot (PK) RNA to force, a number of single molecule pulling experiments have been performed on PKs to decipher the mechanism of programmed ribosomal ...
Denesyuk, Natalia A., Hori, Naoto, Thirumalai, D.   +2 more
core   +2 more sources

Conformation of an RNA pseudoknot

Journal of Molecular Biology, 1990
The structure of the 5' GCGAUUUCUGACCGCUUUUUUGUCAG 3' RNA oligonucleotide was investigated using biochemical and chemical probes and nuclear magnetic resonance spectroscopy. Formation of a pseudoknot is indicated by the imino proton spectrum. Imino protons are observed consistent with formation of two helical stem regions; nuclear Overhauser ...
Joseph D. Puglisi, Jacqueline R. Wyatt, Ignacio Tinoco   +2 more
openalex   +4 more sources

RNA pseudoknots

Current Opinion in Structural Biology, 1994
Many new RNA pseudoknot structures have been detected and proposed in the past year. Although we are still waiting for the first detailed structure of a pseudoknot, their role in processes such as translational autoregulation or ribosomal frameshifting has been extensively studied and is now well established.
Cornelis W.A. Pleij
openalex   +2 more sources

Prediction of RNA pseudoknots using heuristic modeling with mapping and sequential folding.

PLoS ONE, 2007
Predicting RNA secondary structure is often the first step to determining the structure of RNA. Prediction approaches have historically avoided searching for pseudoknots because of the extreme combinatorial and time complexity of the problem.
Wayne K Dawson, Kazuya Fujiwara, Gota Kawai   +2 more
doaj   +3 more sources

PseudoBase: a database with RNA pseudoknots [PDF]

Nucleic Acids Research, 2000
PseudoBase is a database containing structural, functional and sequence data related to RNA pseudo-knots. It can be reached at http://wwwbio. Leiden Univ.nl/ approximately Batenburg/PKB.html. This page will direct the user to a retrieval page from where a particular pseudoknot can be chosen, or to a submission page which enables the user to add ...
F. H. D. van Batenburg
openalex   +4 more sources