Results 21 to 30 of about 26,439 (217)

Novel endoribonucleases as central players in various pathways of eukaryotic RNA metabolism [PDF]

, 2010
For a long time it has been assumed that the decay of RNA in eukaryotes is mainly carried out by exoribonucleases, which is in contrast to bacteria, where endoribonucleases are well documented to initiate RNA degradation.
Andrzej Dziembowski, Rafal Tomecki, Tomecki, Rafał, Dziembowski, Andrzej   +3 more
core   +1 more source

Organization and expression analysis of 5S and 45S ribosomal DNA clusters in autotetraploid Carassius auratus

BMC Ecology and Evolution, 2021
Background Autotetraploid Carassius auratus (4n = 200, RRRR) (abbreviated as 4nRR) is derived from whole genome duplication of Carassius auratus red var. (2n = 100, RR) (abbreviated as RCC).
Chun Zhao, Yuxin Zhang, Huan Qin, Chongqing Wang, Xu Huang, Li Yang, Tingting Yu, Xidan Xu, Xiang Luo, Qinbo Qin, Shaojun Liu   +10 more
doaj   +1 more source

Distinct ribosome maturation defects in yeast models of Diamond-Blackfan anemia and Shwachman-Diamond syndrome

Haematologica, 2010
Background Diamond-Blackfan anemia and Shwachman-Diamond syndrome are inherited bone marrow failure syndromes linked to defects in ribosome synthesis.
Joseph B. Moore, Jason E. Farrar, Robert J. Arceci, Johnson M. Liu, Steven R. Ellis   +4 more
doaj   +1 more source

Purification of 70S Ribosomes from Bacillus subtilis

Bio-Protocol, 2015
The eubacterial ribosome (70S) is a macromolecular complex that is composed of a small (30S) subunit and a large (50S) subunit. The small subunit comprises the 16S ribosomal RNA (rRNA) and more than 20 ribosomal proteins (r-proteins), whereas the large ...
Shota Suzuki, Genki Akanuma, Fujio Kawamura   +2 more
doaj   +1 more source

Two thraustochytrid 5S ribosomal RNAs

Nucleic Acids Research, 1982
The complete nucleotide sequences of the 5S ribosomal RNAs (rRNAs) of two thraustochytrids, Thraustochytrium visurgense and Schizochytrium, aggregatum, are AUGAGCCCUCAUAUCAUGUGGAGUGCACCGGAUCUCAUCCGAACUCCGUAGUUAAGCCACAUAGAGCGCGUC UAGUACUGCCGUAGGGGACUAGGUGGGAAGCACGCGUGGGGCUCAUU and ACAGCCGUUCAUACCACACGGAGA ...
R M, MacKay, W F, Doolittle
openaire   +3 more sources

Molecular genetic analysis of siRNA biogenesis and function in Arabidopsis thaliana [PDF]

, 2009
In diverse eukaryotes, small RNA products of Dicer-like (DCL) proteins regulate mRNA stability or translation, and direct chromatin modifications to genomic regions, phenomena collectively known as RNA silencing.
Blevins, Todd Lucas
core   +1 more source

The complete chloroplast genome of Juniperus squamata (Cupressaceae), a shrubby conifer from Asian Mountains

Mitochondrial DNA. Part B. Resources, 2019
The complete chloroplast genome of Juniperus squamata, a shrubby conifer of ornamental value, is determined in this study. The complete chloroplast genome size is 127,792 bp in length.
Siyu Xie, Jialiang Li, Jibin Miao, Jingjing Xu, Kangshan Mao   +4 more
doaj   +1 more source

In vitro Assessment of RNA Polymerase I Activity

Bio-Protocol, 2017
In eukaryotic cells transcriptional processes are carried out by three different RNA polymerases: RNA polymerase I which specifically transcribes ribosomal RNA (rRNA), RNA polymerase II which transcribes protein-coding genes to yield messenger RNAs ...
Marzia Govoni
doaj   +1 more source

5S Ribosomal RNA Is an Essential Component of a Nascent Ribosomal Precursor Complex that Regulates the Hdm2-p53 Checkpoint

Cell Reports, 2013
Recently, we demonstrated that RPL5 and RPL11 act in a mutually dependent manner to inhibit Hdm2 and stabilize p53 following impaired ribosome biogenesis.
Giulio Donati, Suresh Peddigari, Carol A. Mercer, George Thomas   +3 more
doaj   +1 more source

Kinetoplastid Specific RNA-Protein Interactions in Trypanosoma cruzi Ribosome Biogenesis. [PDF]

PLoS ONE, 2015
RNA binding proteins (RBP) play essential roles in the highly conserved and coordinated process of ribosome biogenesis. Our laboratory has previously characterized two essential and abundant RBPs, P34 and P37, in Trypanosoma brucei which are required for
Khan Umaer, Noreen Williams
doaj   +1 more source