Results 21 to 30 of about 40,749 (233)

Two thraustochytrid 5S ribosomal RNAs

Nucleic Acids Research, 1982
The complete nucleotide sequences of the 5S ribosomal RNAs (rRNAs) of two thraustochytrids, Thraustochytrium visurgense and Schizochytrium, aggregatum, are AUGAGCCCUCAUAUCAUGUGGAGUGCACCGGAUCUCAUCCGAACUCCGUAGUUAAGCCACAUAGAGCGCGUC UAGUACUGCCGUAGGGGACUAGGUGGGAAGCACGCGUGGGGCUCAUU and ACAGCCGUUCAUACCACACGGAGA ...
R M, MacKay, W F, Doolittle
openaire   +3 more sources

5S Ribosomal RNA data bank

Nucleic Acids Research, 1999
This paper presents the updated version of the data base of ribosomal 5S ribonucleic acids (5S rRNA) and their genes (5S rDNA). This edition of the data bank contains 1889 primary structures of 5S rRNA and 5S rDNA. These include 60 archaebacterial, 439 eubacterial, 63 plastid, 9 mitochondrial and 1318 eukaryotic sequences.
M, Szymanski, M Z, Barciszewska, J, Barciszewski, V A, Erdmann   +3 more
openaire   +3 more sources

Distinct ribosome maturation defects in yeast models of Diamond-Blackfan anemia and Shwachman-Diamond syndrome

Haematologica, 2010
Background Diamond-Blackfan anemia and Shwachman-Diamond syndrome are inherited bone marrow failure syndromes linked to defects in ribosome synthesis.
Joseph B. Moore, Jason E. Farrar, Robert J. Arceci, Johnson M. Liu, Steven R. Ellis   +4 more
doaj   +1 more source

Purification of 70S Ribosomes from Bacillus subtilis

Bio-Protocol, 2015
The eubacterial ribosome (70S) is a macromolecular complex that is composed of a small (30S) subunit and a large (50S) subunit. The small subunit comprises the 16S ribosomal RNA (rRNA) and more than 20 ribosomal proteins (r-proteins), whereas the large ...
Shota Suzuki, Genki Akanuma, Fujio Kawamura   +2 more
doaj   +1 more source

The complete chloroplast genome of Juniperus squamata (Cupressaceae), a shrubby conifer from Asian Mountains

Mitochondrial DNA. Part B. Resources, 2019
The complete chloroplast genome of Juniperus squamata, a shrubby conifer of ornamental value, is determined in this study. The complete chloroplast genome size is 127,792 bp in length.
Siyu Xie, Jialiang Li, Jibin Miao, Jingjing Xu, Kangshan Mao   +4 more
doaj   +1 more source

In vitro Assessment of RNA Polymerase I Activity

Bio-Protocol, 2017
In eukaryotic cells transcriptional processes are carried out by three different RNA polymerases: RNA polymerase I which specifically transcribes ribosomal RNA (rRNA), RNA polymerase II which transcribes protein-coding genes to yield messenger RNAs ...
Marzia Govoni
doaj   +1 more source

Kinetoplastid Specific RNA-Protein Interactions in Trypanosoma cruzi Ribosome Biogenesis. [PDF]

PLoS ONE, 2015
RNA binding proteins (RBP) play essential roles in the highly conserved and coordinated process of ribosome biogenesis. Our laboratory has previously characterized two essential and abundant RBPs, P34 and P37, in Trypanosoma brucei which are required for
Khan Umaer, Noreen Williams
doaj   +1 more source

The nucleolar RNA methyltransferase Misu (NSun2) is required for mitotic spindle stability [PDF]

, 2009
Myc-induced SUN domain–containing protein (Misu or NSun2) is a nucleolar RNA methyltransferase important for c-Myc–induced proliferation in skin, but the mechanisms by which Misu contributes to cell cycle progression are unknown.
Shobbir Hussain, Sandra Blanco Benavente, Elisabete Nascimento, Ilaria Dragoni, Agata Kurowski, Astrid Gillich, Peter Humphreys, Michaela Frye, Agris, Agris, Albee, Andersen, Andrews, Arnold, Blower, Blower, Boisvert, Brzezicha, Bujnicki, Clarke, Dephoure, Eliscovich, Frye, Frye, Gautier, Goshima, Greasley, Grosjean, Gruss, King, Liau, Ma, Nachury, Obara, Oeffinger, Raemaekers, Ribbeck, Rogakou, Sakita-Suto, Sato, Schmit, Schug, Taylor, Trieselmann, Tsai, Tscherne, Waikel, Watt, Wiese, Wu   +49 more
core   +1 more source

5S Ribosomal RNA Is an Essential Component of a Nascent Ribosomal Precursor Complex that Regulates the Hdm2-p53 Checkpoint

Cell Reports, 2013
Recently, we demonstrated that RPL5 and RPL11 act in a mutually dependent manner to inhibit Hdm2 and stabilize p53 following impaired ribosome biogenesis.
Giulio Donati, Suresh Peddigari, Carol A. Mercer, George Thomas   +3 more
doaj   +1 more source

Identification of Sex and Female's Reproductive Stage in Commercial Fish Species through the Quantification of Ribosomal Transcripts in Gonads. [PDF]

PLoS ONE, 2016
The estimation of maturity and sex of fish stocks in European waters is a requirement of the EU Data Collection Framework as part of the policy to improve fisheries management.
Iratxe Rojo-Bartolomé, Oihane Diaz de Cerio, Guzman Diez, Ibon Cancio   +3 more
doaj   +1 more source