Results 31 to 40 of about 49,863 (209)

Aquaporin evolution in fishes

Frontiers in Physiology, 2011
Aquaporins represent a primordial group of transmembrane solvent channels that have been documented throughout the living biota. This facet alone emphasizes the positive selection pressure for proteins associated with intracellular fluid homeostasis ...
Roderick Nigel eFinn, Roderick Nigel eFinn, Joan eCerdà   +2 more
doaj   +1 more source

The male and female gonad transcriptome of the edible sea urchin, Paracentrotus lividus: Identification of sex-related and lipid biosynthesis genes

Aquaculture Reports, 2022
Paracentrotus lividus is the most abundant, geographically distributed, and desirable echinoid species in Europe. Although economically important, this species has scarce genomic resources available.
André M. Machado, Sergio Fernández-Boo, Manuel Nande, Rui Pinto, Benjamin Costas, L. Filipe C. Castro   +5 more
doaj   +1 more source

Targeting Muscle-Specific E3 Ligases in Cancer Cachexia Through Structure-Based Virtual Screening of Small-Molecule Inhibitors

microPublication Biology
Cachexia is a multifactorial metabolic syndrome characterized by severe skeletal muscle loss that cannot be reversed by nutritional support. Common in cancer and other chronic diseases, it significantly increases morbidity and mortality.
Irfana Muqbil, Jordan D Johnson
doaj   +1 more source

Effects of Candidatus Liberibacter asiaticus infection on metagenome of Diaphorina citri gut endosymbiont

Scientific Data, 2023
Asian citrus psyllid (Diaphorina citri, D. citri) is the important vector of “Candidatus Liberibacter asiaticus” (CLas), associated with Huanglongbing, the most devastating citrus disease worldwide. CLas can affect endosymbiont abundance of D.
Qi Pan, Shi-Jiang Yu, Shuang Lei, Si-Chen Li, Li-Li Ding, Liu Liu, Lu-Yan Cheng, Ren Luo, Cui-Yun Lei, Bing-Hai Lou, Lin Cong, Hao-Qiang Liu, Xue-Feng Wang, Chun Ran   +13 more
doaj   +1 more source

Diurnal shifts in eDNA concentration of threatened juvenile river herring

microPublication Biology
River herring, Alosa species, are threatened in North Carolina waters. Environmental DNA (eDNA) is a non-invasive approach to monitor their movement. River herring, particularly juveniles, are known to exhibit diurnal shifts within water columns.
Camden G. Bailey, Chase G. Spicer, William Langley, Cory S. Joyner, Patrick Harris, Roger A. Rulifson, Erin K. Field   +6 more
doaj   +1 more source

Purification and pigment analysis of diadinoxanthin-binding PSI-LHCI supercomplexes from Euglena gracilis strain Z

microPublication Biology
Euglena gracilis exhibits a unique pigment profile distinct from land plants and green algae. In this study, we purified photosystem I supercomplexes containing light-harvesting complexes (PSI-LHCI) from E.
Runa Sakamoto, Ibuki Y. Takahashi, Koji Kato, Yoshiki Nakajima, Jian-Ren Shen, Ryo Nagao   +5 more
doaj   +1 more source

seqAll_mixEUK

, 2016
Demultiplexing file from MiSEQ sequencing (2 x 250 bp) of a Mock community (16 species) amplifiying with the following primers: 960F: GGCTTAATTTGACTCAACRCG 1419R: GGGCATCACAGACCTGTTAT For obtaining this file, the paired-end reads were merged together ...
Emilie Gauthier (3254304), Charly Massa (3254280), Millet, Laurent, Eric Capo (3254283), Isabelle Domaizon (293490), Gauthier, Emilie, Domaizon, Isabelle, Typhaine Guillemot (3254307), Develle, Anne-Lise, Capo, Eric, Laurent Millet (847547), Anne-Lise Develle (3254286), Massa, Charly, Didier Debroas (151900), Cecile Pignol (2927022), Guillemot, Typhaine, Arnaud, Fabien, Debroas, Didier, Fabien Arnaud (1680166), Vincent Bichet (3254310), Franck Lejzerowicz (2151814), Pignol, Cecile, Bichet, Vincent, Lejzerowicz, Franck   +23 more
core   +1 more source

Parasitism in Eukaryota - Reconstruction of Ancestral and Unavailable Extant States [PDF]

Biodiversity Information Science and Standards, 2018
Parasitism can be defined as an interaction between species in which one of the interaction partners, the parasite, lives in or on the other, the host. The parasite draws food from its host and harms it in the process. According to some estimates, over 40% of all eukaryotes are parasites.
Lydia Buntrock, Bernhard Renard, Emanuel Heitlinger   +2 more
openaire   +2 more sources

Carapics: A Web-based Platform for Semi-quantitative Analysis of Structural Change in Biological Samples

microPublication Biology
Environmental stress can alter and damage biological structures with functional consequences. Inspired by observations of Tanner crabs after 2-year exposure to ocean acidification, we observed that crabs held at low pH appeared to have damaged claws ...
Gary H. Dickinson, Sejong Yoon, Nate Sorvino, Sameer Kamal, Corin J. Hoppe, Isra Ahmad, W. Christopher Long   +6 more
doaj   +1 more source

Crystal structure of human NIF3‐like protein reveals dynamic hexameric assembly with a single divalent metal binding site

The FEBS Journal, EarlyView.
We present the first crystal structures of human NIF3, revealing a dynamic, hexameric ring with a central cavity regulated by flexible insertion domains. Crucially, human NIF3 features a mononuclear zinc‐binding site, marking a distinct evolutionary departure from the dinuclear centers of bacterial homologs.
Elżbieta Wątor‐Wilk, Krzysztof Żak, Piotr Wilk, Paweł Kochanowski, Agnieszka Maślanka, Łukasz Skalniak, Przemysław Grudnik   +6 more
wiley   +1 more source