Results 51 to 60 of about 48,011 (202)
Molecular evolution of FtsZ protein sequences encoded within the genomes of archaea, bacteria, and eukaryota. [PDF]
, 2004 The FtsZ protein is a polymer-forming GTPase which drives bacterial cell division and is structurally and functionally related to eukaryotic tubulins.
Vaughan, S +4 more
core +1 more source
Stu2 lysines 469 and 870 are evolutionarily conserved. [PDF]
, 2022 (A) The location of acetyl-lysines are indicated relative to distinct Stu2 domains and (B) are illustrated in a Stu2 structure predicted by I-TASSER. Clustal protein alignments are shown for members of the Stu2/XMAP215 family of microtubule polymerases ...
Jeremy A. Sabo (13767937) +4 more
core +1 more source
Scientific Data, 2023 Asian citrus psyllid (Diaphorina citri, D. citri) is the important vector of “Candidatus Liberibacter asiaticus” (CLas), associated with Huanglongbing, the most devastating citrus disease worldwide. CLas can affect endosymbiont abundance of D.
Qi Pan +13 more
doaj +1 more source
, 2016 Demultiplexing file from MiSEQ sequencing (2 x 250 bp) of a Mock community (16 species) amplifiying with the following primers: 960F: GGCTTAATTTGACTCAACRCG 1419R: GGGCATCACAGACCTGTTAT For obtaining this file, the paired-end reads were merged together ...
Emilie Gauthier (3254304) +23 more
core +1 more source
Cytoskeletal organization, phylogenetic affinities and systematics in the contentious taxon Excavata (Eukaryota) [PDF]
INTERNATIONAL JOURNAL OF SYSTEMATIC AND EVOLUTIONARY MICROBIOLOGY, 2003 An overview of the controversial proposal for the major eukaryote taxon "Excavata" is presented. Excavata is predicted to include at least ten distinct groups: jakobids, Malawimonas, Trimastix, Carpediemonas, retortamonads, diplomonads, Heterolobosea, oxymonads, parabasalids and Euglenozoa.
Alastair G.B. Simpson +2 more
openaire +3 more sources
The Role of Peroxiredoxins in Cancer Development
Biology, 2023 Peroxiredoxins (Prxs) are antioxidant enzymes with ubiquitous expression in human tissues. Prxs are expressed in archaea, bacteria, and eukaryota, often in multiple isoforms.
Pratik Thapa +5 more
doaj +1 more source
Cystinosin, MPDU1, SWEETs and KDELR belong to a well-defined protein family with putative function of cargo receptors involved in vesicle trafficking. [PDF]
PLoS ONE, 2012 Classification of proteins into families based on remote homology often helps prediction of their biological function. Here we describe prediction of protein cargo receptors involved in vesicle formation and protein trafficking.
Vladimir Saudek
doaj +1 more source
Parasitism in Eukaryota - Reconstruction of Ancestral and Unavailable Extant States [PDF]
Biodiversity Information Science and Standards, 2018 Parasitism can be defined as an interaction between species in which one of the interaction partners, the parasite, lives in or on the other, the host. The parasite draws food from its host and harms it in the process. According to some estimates, over 40% of all eukaryotes are parasites.
Lydia Buntrock +2 more
openaire +2 more sources
Stool microbiome dataset of the critically endangered Puerto Rican parrot (Amazona vittata)
Data in Brief, 2021 The Puerto Rican parrot (Amazona vittata), endemic to Puerto Rico, is the only native parrot in the United States and is classified as a critically endangered species. There are two captive populations of A.
Miguel G. Rodriguez-Reyes +1 more
doaj +1 more source
Proteins: Structure, Function, and Bioinformatics, EarlyView.ABSTRACT Proteins are built from modular domains that serve as fundamental units of structure and evolution. While individual domains have been extensively cataloged, their collective distribution across the lineages of life has remained poorly resolved.
Rui Guo +5 more
wiley +1 more source