Results 41 to 50 of about 960 (153)
Harmful algal blooms (HABs) have been increasingly recorded over the last decades and much work has linked these events to multiple oceanographic and climate disturbances.
Antonio Fernández +10 more
doaj +1 more source
Published as part of Sun, Pengfei, Leeson, Cristian, Zhi, Xiaoduo, Leng, Fenfei, Pierce, Richard H., Henry, Michael S. & Rein, Kathleen S., 2016, Characterization of an epoxide hydrolase from the Florida red tide dinoflagellate, Karenia brevis, pp.
Sun, Pengfei +6 more
openaire +2 more sources
4.7. Cloning and expression of K. brevis EH1 Contig MGID2034061 of a K. brevis EST library (Lidie et al., 2005) was synthesized (after optimization of codon usage for E. coli expression) and cloned into pUC 57 by Genescript. The insert was subcloned into pET30a+ vector for protein expression: Specific primers (Forward: CACAATCATATGCCGCTGACGGA ...
Sun, Pengfei +6 more
openaire +2 more sources
Exposure of common bottlenose dolphins (Tursiops truncatus) to brevetoxins (PbTx) produced by blooms of the toxic phytoplankton Karenia brevis frequently results in severe health impacts, including illness and large-scale mortality events.
Spencer E. Fire +3 more
doaj +1 more source
Patterns in evolutionary origins of heme, chlorophyll a and isopentenyl diphosphate biosynthetic pathways suggest non-photosynthetic periods prior to plastid replacements in dinoflagellates [PDF]
Background The ancestral dinoflagellate most likely established a peridinin-containing plastid, which have been inherited in the extant photosynthetic descendants.
Eriko Matsuo, Yuji Inagaki
doaj +2 more sources
Karenia brevis subsp. homogenate
4.3. Preparation of K. brevis homogenate K. brevis culture (200 ml) was concentrated by centrifugation (5 min at 450× g) and the supernatant discarded. The cells were resuspended in phosphate buffer (800 Ll, 50 mM pH 7.0) and vortexed for 1 min. This suspension was centrifuged (14,000× g for 10 min) and the pellet was discarded.
Sun, Pengfei +6 more
openaire +2 more sources
Interaction of a dinoflagellate neurotoxin with voltage-activated ion channels in a marine diatom [PDF]
Background The potent neurotoxins produced by the harmful algal bloom species Karenia brevis are activators of sodium voltage-gated channels (VGC) in animals, resulting in altered channel kinetics and membrane hyperexcitability.
Sheila A. Kitchen +2 more
doaj +2 more sources
Horizontal gene transfer in chromalveolates
Background Horizontal gene transfer (HGT), the non-genealogical transfer of genetic material between different organisms, is considered a potentially important mechanism of genome evolution in eukaryotes. Using phylogenomic analyses of expressed sequence
Bhattacharya Debashish, Nosenko Tetyana
doaj +1 more source
Red tide blooms caused by the toxic dinoflagellate Karenia brevis are natural disturbance events that occur regularly along Florida’s west coast, often resulting in massive fish kills and marine mammal, seabird, and sea turtle mortalities.
Elizabeth J. Berens McCabe +5 more
doaj +1 more source
Localization of polyketide synthase encoding genes to the toxic dinoflagellate Karenia brevis [PDF]
Karenia brevis is a toxic marine dinoflagellate endemic to the Gulf of Mexico. Blooms of this harmful alga cause fish kills, marine mammal mortalities and neurotoxic shellfish poisonings. These harmful effects are attributed to a suite of polyketide secondary metabolites known as the brevetoxins.
Snyder, Richard V. +6 more
openaire +4 more sources

