Results 21 to 30 of about 1,522 (191)

Brevetoxin Dynamics and Bioavailability from Floc Following PAC-Modified Clay Treatment of Karenia brevis Blooms [PDF]

Toxins
Harmful algal blooms (HABs) caused by the dinoflagellate Karenia brevis present serious ecological and public health concerns due to the production of brevetoxins (BTX).
Nicholas R. Ohnikian, Christopher D. Sibley, R. Ben Freiberger, Kristen N. Buck, Alyssa Myers, Samantha Harlow, Donald M. Anderson, Richard Pierce, Jennifer H. Toyoda   +8 more
doaj   +2 more sources

Karenia brevis EH

, 2016
4.7. Cloning and expression of K. brevis EH1 Contig MGID2034061 of a K. brevis EST library (Lidie et al., 2005) was synthesized (after optimization of codon usage for E. coli expression) and cloned into pUC 57 by Genescript. The insert was subcloned into pET30a+ vector for protein expression: Specific primers (Forward: CACAATCATATGCCGCTGACGGA ...
Sun, Pengfei, Leeson, Cristian, Zhi, Xiaoduo, Leng, Fenfei, Pierce, Richard H., Henry, Michael S., Rein, Kathleen S.   +6 more
openaire   +3 more sources

Brevetoxin-Producing Spherical Cells Present in Karenia brevis Bloom: Evidence of Morphological Plasticity?

Journal of Marine Science and Engineering, 2019
Spherical cells were detected in low salinity waters during a bloom of Karenia brevis in Alabama coastal waters. These balls resembled K. brevis in size and organelle appearance, contained similar concentration of brevetoxin, and occurred during ongoing ...
Lucie Novoveská, Alison Robertson, Robertson Alison   +2 more
exaly   +3 more sources

Targeting Florida red tide: Curcumin inhibits Karenia brevis thioredoxin reductase. [PDF]

Plant Physiol Biochem
Recurring blooms of the Florida red tide dinoflagellate Karenia brevis, a type of harmful algal bloom (HAB), result in adverse economic, environmental, and public health outcomes. These effects have been largely attributed to the production of a suite of neurotoxins known as the brevetoxins.
Taher E, Liu Y, Hondal RJ, Rein KS.
europepmc   +3 more sources

Friends and foes: symbiotic and algicidal bacterial influence on Karenia brevis blooms. [PDF]

ISME Commun
Abstract Harmful Algal Blooms (HABs) of the toxigenic dinoflagellate Karenia brevis (KB) are pivotal in structuring the ecosystem of the Gulf of Mexico (GoM), decimating coastal ecology, local economies, and human health. Bacterial communities associated with toxigenic phytoplankton species play an important role in influencing toxin ...
Fei C, Booker A, Klass S, Vidyarathna NK, Ahn SH, Mohamed AR, Arshad M, Glibert PM, Heil CA, Martínez Martínez J, Amin SA.   +10 more
europepmc   +3 more sources

Role of Biomarkers in Monitoring Brevetoxins in Karenia brevis Exposed Shellfish. [PDF]

Food Saf (Tokyo), 2018
Monitoring and management programs for marine toxins in seafood depend on efficient detection tools for their success in protecting public health. Here we review current methods of detection for neurotoxic shellfish poisoning (NSP) toxins, and current knowledge in brevetoxin metabolism in shellfish.
Abraham A, El Said KR, Flewelling LJ.
europepmc   +3 more sources

De novo assembly and characterization of the transcriptome of the toxic dinoflagellate Karenia brevis. [PDF]

BMC Genomics, 2014
Karenia brevis is a harmful algal species that blooms in the Gulf of Mexico and produces brevetoxins that cause neurotoxic shellfish poisoning. Elevated brevetoxin levels in K. brevis cells have been measured during laboratory hypo-osmotic stress treatments. To investigate mechanisms underlying K. brevis osmoacclimation and osmoregulation and establish
Ryan DE, Pepper AE, Campbell L.
europepmc   +4 more sources

Osmotic stress does not trigger brevetoxin production in the dinoflagellate Karenia brevis. [PDF]

Proc Natl Acad Sci U S A, 2013
With the global proliferation of toxic harmful algal bloom species, there is a need to identify the environmental and biological factors that regulate toxin production. One such species,Karenia brevis, forms nearly annual blooms that threaten coastal regions throughout the Gulf of Mexico.
Sunda WG, Burleson C, Hardison DR, Morey JS, Wang Z, Wolny J, Corcoran AA, Flewelling LJ, Van Dolah FM.   +8 more
europepmc   +6 more sources

Chimeric Plastid Proteome in the Florida “Red Tide” Dinoflagellate Karenia brevis

Molecular Biology and Evolution, 2006
Current understanding of the plastid proteome comes almost exclusively from studies of plants and red algae. The proteome in these taxa has a relatively simple origin via integration of proteins from a single cyanobacterial primary endosymbiont and the host.
Tetyana Nosenko, Frances M Van Dolah, Jan-Fang Cheng   +2 more
exaly   +3 more sources

Global analysis of mRNA half-lives and de novo transcription in a dinoflagellate, Karenia brevis. [PDF]

PLoS ONE, 2013
Dinoflagellates possess many physiological processes that appear to be under post-transcriptional control. However, the extent to which their genes are regulated post-transcriptionally remains unresolved.
Jeanine S Morey, Frances M Van Dolah
doaj   +2 more sources