Results 51 to 60 of about 26,439 (217)

Clustering of bacteria by the triplet composition of 5S RNA [PDF]

open access: yesITM Web of Conferences
The relationship between the structure of nucleotide sequences, the function they encode, and the taxonomy of the host is an important subject of study for molecular biologists and bioinformaticians, as well as specialists in processing big data arrays ...
Ovchinnikova Iuliia   +2 more
doaj   +1 more source

Role of 5S RNA in the Functions of 50S Ribosomal Subunits [PDF]

open access: yesProceedings of the National Academy of Sciences, 1971
50S ribosomal subunits from Bacillus stearothermophilus can be reconstituted from their dissociated components, namely a 5S RNA-free protein fraction, a 5S RNA-free 23S ribosomal RNA fraction, and purified 5S RNA.
V A, Erdmann   +3 more
openaire   +2 more sources

Prospects of multipurpose biomonitoring for fisheries assessment based on environmental nucleic acids

open access: yesJournal of Fish Biology, EarlyView.
Abstract Methods using environmental nucleic acids have become highly effective for monitoring aquatic biodiversity, with an array of suitable use cases, including metrics for fisheries assessment. Traditional methods for assessing fish populations often rely on invasive techniques with limited spatial and temporal coverage.
Ana Ramón‐Laca   +6 more
wiley   +1 more source

Overexpression of a Brix Domain-Containing Ribosome Biogenesis Factor ARPF2 and its Interactor ARRS1 Causes Morphological Changes and Lifespan Extension in Arabidopsis thaliana

open access: yesFrontiers in Plant Science, 2018
The Brix domain is a conserved domain in several proteins involved in ribosome biogenesis in yeast and animals. In the Arabidopsis genome, six Brix domain-containing proteins are encoded; however, their molecular functions have not been fully ...
Shugo Maekawa   +2 more
doaj   +1 more source

Insights Into the Origin and Local Adaptation Evolution of the Cultivated Sesame With Telomere‐to‐Telomere High‐Quality Genome

open access: yesPlant Biotechnology Journal, EarlyView.
ABSTRACT Sesame (Sesamum indicum L., 2n = 26) is one of the oldest oilseed crops and is often called the ‘queen of oilseeds’ due to its high content of unsaturated fatty acids and natural antioxidants. Despite its long history, the origin and global spread of cultivated sesame remain unresolved.
Weifei Yang   +16 more
wiley   +1 more source

Function of the upstream activating factor in chromatin structure organization and transcriptional regulation at the yeast ribosomal DNA

open access: yes, 2010
Chromatin is the template of all processes involved in DNA metabolism in the eukaryotic cell. Accordingly, chromatin is a dynamic structure which changes in its composition and posttranslational modification correlating with the functional state of a ...
Götze, Hannah
core   +1 more source

Circular RNAs in Lotus japonicus Responses to Nutrient Supply and Mesorhizobium Symbiosis

open access: yesPlant, Cell &Environment, EarlyView.
ABSTRACT Symbiotic interactions between legumes and rhizobia enable nitrogen fixation under low nutrient conditions. The establishment and function of symbiotic interactions require coordinated changes in gene expression in both the host and the microbe. Circular RNAs (circRNAs) are endogenous gene‐specific molecules that can regulate transcription and
Delecia Utley   +3 more
wiley   +1 more source

Karyotyping and in situ chromosomal localization of rDNA sites in black cumin Bunium persicum (Boiss) B. Fedtsch,1915 (Apiaceae)

open access: yesComparative Cytogenetics, 2011
The fluorescent in situ hybridization (FISH) technique has been applied to somatic chromosomes in the medicinally important species, Bunium persicum, to elucidate its karyotypes.
R. K. Chahota   +4 more
doaj   +1 more source

Oocyte and somatic 5S ribosomal RNA and 5S RNA encoding genes in Xenopus tropicalis

open access: yesNucleic Acids Research, 1988
We have investigated the structure of oocyte and somatic 5S ribosomal RNA and of 5S RNA encoding genes in Xenopus tropicalis. The sequences of the two 5S RNA families differ in four positions, but only one of these substitutions, a C to U transition in position 79 within the internal control region of the corresponding 5S RNA encoding genes, is a ...
W, Nietfeld   +7 more
openaire   +3 more sources

The sequence of the 5S ribosomal RNA of the crustacean Artemia salina [PDF]

open access: yesNucleic Acids Research, 1981
The primary structure of the 5 S rRNA isolated from the cryptobiotic cysts of the brine shrimp Artemia salina is pACCAACGGCCAUACCACGUUGAAAGUACCCAGUCUCGUCAGAUCCUGGAAGUCACACAACGUCGGGCCCGGUCAGUACUUGGAUGGGUGACCGCCUGGGAACACCGGGUGCUGUUGGCAU (OH).
L, Diels   +3 more
openaire   +2 more sources

Home - About - Disclaimer - Privacy