Results 31 to 40 of about 2,635,483 (291)

Safe and Sound: Proceedings of the 27th Annual International Conference on Auditory Display

, 2022
Presented at the 27th International Conference on Auditory Display (ICAD 2022) 24-27 June 2022, Virtual conference.Complete proceedings of the 27th International Conference on Auditory Display (ICAD2022), June 24-27.

core   +1 more source

A porcine gene, PBK, differentially expressed in the longissimus muscle from Meishan and Large White pig

Genetics and Molecular Biology, 2009
An investigation of differences in gene expression in the longissimus muscle of Meishan and Large White pigs was undertaken, using the mRNA display technique.
Liu Yonggang, Zhao Sumei, Pan Hongbin, Gao Shizheng   +3 more
doaj   +1 more source

Impact of Radiation Therapy on Physical and Psychosocial Health of Adolescents and Young Adults: A Joint Report From the Children's Oncology Group AYA and Radiation Oncology Committees

Pediatric Blood &Cancer, EarlyView.
ABSTRACT Rates of cancer among adolescents and young adults (AYA), age 15–39 years, are increasing. Consequently, radiation oncologists are treating more AYAs who have diagnoses spanning both pediatric and adult practices. Compared to pediatric and older adult patients, AYAs face a unique set of challenges.
Hesham Elhalawani, Rachel K. Peterson, Avani D. Rao, Laurie J. McKenzie, Ahmed Magdy Elmotayam, Leslie Chang, Michael Roth, Susan L. McGovern   +7 more
wiley   +1 more source

Electrophoretic Signal Comparison Applied to mRNA Differential Display Analysis

BioTechniques, 2003
Gene expression analysis by electrophoretic methods is currently limited by the labor-intensive visual evaluation of the electrophoretic signal profiles.
T. Aittokallio, T. Pahikkala, P. Ojala, T.J. Nevalainen, O. Nevalainen   +4 more
doaj   +1 more source

Social Functioning Within the First Years After Pediatric Brain Tumor Diagnosis and the Relationship With Family Psychosocial Risk

Pediatric Blood &Cancer, EarlyView.
ABSTRACT Background Survivors of pediatric brain tumors (PBTs) can experience long‐term social difficulties, impacting quality of life. Beyond medical and environmental factors, family psychosocial risk may play a role in social outcomes by shaping the caregiving environment and may provide intervention options.
Renske H. Houben, Marisa H. Huisman, Martha A. Grootenhuis, Femke K. Aarsen, Marita Partanen   +4 more
wiley   +1 more source

Automated Differential Display Using a Fluorescently Labeled Universal Primer

BioTechniques, 1997
We have modified the automated differential display reverse transcription polymerase chain reaction technique (DDRTPCR) such that a single fluorescently labeled universal primer (d[F]CTCACGGATCCGTCGATTTT) is used in all PCRs together with a selection of ...
N.R. Smith, M. Aldersley, A. Li, A.S. High, T.P. Moynihan, A.F. Markham, P.A. Robinson   +6 more
doaj   +1 more source

Retrospective Analysis of Donor Lymphocyte Infusions in Pediatric Patients With Mixed Chimerism After Hematopoietic Stem Cell Transplantation

Pediatric Blood &Cancer, EarlyView.
ABSTRACT Background Allogeneic hematopoietic stem cell transplantation (alloHSCT) is an essential therapy for several malignant and nonmalignant diseases, but relapse and graft loss remain the principal threats to its success. Routine monitoring of chimerism and minimal residual disease (MRD) enables early detection of imminent recurrence and guides ...
Carmen Junk, Sebastian Michaelis, Michaela Döring, Thomas Eichholz, Ursula Holzer, Martin Ebinger, Tim Flaadt, Rupert Handgretinger, Peter Lang, Jan Frederic Weller, Markus Mezger   +10 more
wiley   +1 more source

Virtual-Audio Aided Visual Search on a Desktop Display

, 2016
As visual display complexity grows, visual cues and alerts may become less salient and therefore less effective. Although the auditory system’s resolution is rather coarse relative to the visual system, there is some evidence for virtual spatialized ...
Rothwell, Clayton, Griffin Romigh, Brian Simpson, Simpson, Brian D., Clayton Rothwell, Romigh, Griffin D.   +5 more
core   +1 more source

A perceptual framework for the auditory display of scientific data

, 1994
Presented at 2nd International Conference on Auditory Display (ICAD), Santa Fe, New Mexico, November 7-9, 1994.Presented at 2nd International Conference on Auditory Display (ICAD), Santa Fe, New Mexico, November 7-9, 1994.A principal requirement of the ...
Barrass, Stephen
core   +1 more source

Pediatric Idiopathic Multicentric Castleman Disease Is Often Severe But Responsive to Siltuximab

Pediatric Blood &Cancer, EarlyView.
ABSTRACT Background Idiopathic multicentric Castleman disease (iMCD) is a potentially fatal immunologic disorder marked by widespread lymphadenopathy and inflammation. Siltuximab, an interleukin‐6 (IL‐6) inhibitor, is the only FDA‐approved treatment for adult patients with iMCD.
Bridget Austin, Sheila K. Pierson, Kelley C. Dacus, Mateo Sarmiento Bustamante, Saishravan Shyamsundar, Larissa Borys, Kayla McHugh, Abiola Irvine, Yoojin Jo, Adam Bagg, Mary Jo Lechowicz, Daisy Alapat, Amy Chadburn, Megan S. Lim, Gordan Srkalovic, Frits van Rhee, David C. Fajgenbaum, Joshua D. Brandstadter   +17 more
wiley   +1 more source