Results 41 to 50 of about 1,096,731 (339)
Teaching Partial Differential Equations with CAS [PDF]
Partial Differential Equations (PDE) are one of the topics where Engineering students find more difficulties when facing Math subjects. A basic course in Partial Differential Equations (PDE) in Engineering, usually deals at least, with the following ...
Aguilera-Venegas, Gabriel +5 more
core
ABSTRACT Background and Aims Wilms tumour (WT) has excellent event‐free and overall survival (OS). However, small differences exist between countries participating in the same international study. This led us to examine variation in adherence to protocol recommendations as a potential contributing factor.
Suzanne Tugnait +23 more
wiley +1 more source
Electrophoretic Signal Comparison Applied to mRNA Differential Display Analysis
Gene expression analysis by electrophoretic methods is currently limited by the labor-intensive visual evaluation of the electrophoretic signal profiles.
T. Aittokallio +4 more
doaj +1 more source
ABSTRACT Arteriovenous malformations (AVMs) are rare, high‐flow, vascular anomalies that can occur either sporadically or as part of a genetic syndrome. AVMs can progress with serious morbidity and even mortality if left unchecked. Sirolimus is an mTOR inhibitor that is effective in low‐flow vascular malformations; however, its role in AVMs is unclear.
Will Swansson +3 more
wiley +1 more source
Automated Differential Display Using a Fluorescently Labeled Universal Primer
We have modified the automated differential display reverse transcription polymerase chain reaction technique (DDRTPCR) such that a single fluorescently labeled universal primer (d[F]CTCACGGATCCGTCGATTTT) is used in all PCRs together with a selection of ...
N.R. Smith +6 more
doaj +1 more source
Solving Optimal Power Flow Problem via Improved Constrained Adaptive Differential Evolution
The optimal power flow problem is one of the most widely used problems in power system optimizations, which are multi-modal, non-linear, and constrained optimization problems.
Wenchao Yi +5 more
doaj +1 more source
Patterns on liquid surfaces: cnoidal waves, compactons and scaling
Localized patterns and nonlinear oscillation formation on the bounded free surface of an ideal incompressible liquid are analytically investigated . Cnoidal modes, solitons and compactons, as traveling non-axially symmetric shapes are discused.
A. Ludu +27 more
core +1 more source
ABSTRACT Objective To evaluate the diagnostic yield and utility of universal paired tumor–normal multigene panel sequencing in newly diagnosed pediatric solid and central nervous system (CNS) tumor patients and to compare the detection of germline pathogenic/likely pathogenic variants (PV/LPVs) against established clinical referral criteria for cancer ...
Natalie Waligorski +9 more
wiley +1 more source
Deformations and Extensions of Modified λ-Differential 3-Lie Algebras
In this paper, we propose the representation and cohomology of modified λ-differential 3-Lie algebras. As their applications, the linear deformations, abelian extensions and T∗-extensions of modified λ-differential 3-Lie algebras are also studied.
Wen Teng, Hui Zhang
doaj +1 more source
ABSTRACT Purpose Although not always achieved, complete chemotherapy‐induced nausea and vomiting (CINV) control is the conventional goal of CINV prophylaxis. In this two‐center, mixed‐methods study, we sought to understand the preferences of adolescent patients and family caregivers for CINV control endpoints.
Haley Newman +8 more
wiley +1 more source

