Results 61 to 70 of about 130,862 (133)
Design And Evaluation Of Controlled Release Layered Matrix Tablets Of Paracetamol And Verapamil Hci. [PDF]
, 2009 Tablet matriks berlapis pelepasan terkawal parasetamol dan verapamil HCl dibangunkan menggunakan polimer hidrofilik dan hidrofobik, dan disediakan dengan kaedah pengranulan basah.
Rahamathullah, Shaikh
core +1 more source
Diltiazem inhibits hKv1.5 and Kv4.3 currents at therapeutic concentrations
, 2004 Objective: In the present study we examined the effects of diltiazem, an L-type Ca(2+) channel blocker widely used for the control of the ventricular rate in patients with supraventricular arrhythmias, on hKv1.5 and Kv4.3 channels that generate the ...
Tamargo Menéndez, Juan +5 more
core +1 more source
Surfactant and temperature effects on paraben transport through silicone membranes [PDF]
, 2013 This study investigates the effects of two surfactants (one anionic and one non-ionic) and controlled modifications in temperature (298–323 K) on the permeation of two structurally similar compounds through a silicone membrane using a Franz diffusion ...
Bibi, Aisha +3 more
core +1 more source
, 1970 This investigation describes the preparation and in vitro evaluation of Colonic Drug Delivery of Diltiazem HCl tablet. Methocel K 4M premium, Methocel K 100M premium CR, Methocel K 15M CR and Xanthan gum were used for release controlling properties.
Jakir Ahmed Chowdhury +2 more
core +1 more source
Hcl-1 is expressed in the albumen gland.
, 2016 Amplicons of 440 bp generated by RT-PCR using specific primers, (21F: TTGACGTTACTGACGCCATGA, 23R: AAGTCAAGTTTGTTACCGACGACG), demonstrate that Hcl-1 is only expressed in the AG. For positive control, eIF2α was used.
Janeth J. Peña (3609611) +1 more
core +1 more source
OPTIMASI MORINGA GUM DAN POLIVINIL ALKOHOL DALAM SEDIAAN MUCOADHESIVE BUCCAL FILM DILTIAZEM HIDROKLORIDA [PDF]
. Diltiazem Hydrochloride (HCl) is commonly used in hypertension therapy for its beneficial effects, such as reducing blood vessel pressure resistance and relaxing the heart muscles.
Nani Sukmawati +2 more
core +1 more source
Pharmacokinetics of the calcium-channel blocker diltiazem after a single intravenous dose in horses
, 2006 The pharmacokinetics of diltiazem were determined in eight healthy horses. Diltiazem HCl, 1 mg/kg i.v., was administered over 5 min. Venous blood samples were collected at regular intervals after administration.
Schwarzwald, Colin C; https://orcid.org/ +5 more
core +1 more source
, 2019 Hipertensi merupakan penyakit kardiovaskular dan merupakan salah satu faktor resiko yang dapat meningkatkan jumlah mortalitas dan morbiditas (WHO, 2012), yang dapat ditangani dengan obat golongan penghambat kanal kalsium yaitu Diltiazem Hidroklorida ...
LAKSONO, Bagus TRi
core
Order Management System integrálása HCL Commerce fejlesztői környezetben
, 2022 A dolgozat szerzője finnországi Erasmus képzése során szakmai gyakorlaton vett részt a Solteq Oyj cégnél, ahol egy valós fejlesztői problémára keresett megoldást HCL Commerce (korábban WebSphere Commerce) környezetben.
Mándi, Ákos
core
Influence of HCl on CO and NO emissions in combustion
, 2009 The influence of HCl on CO and NO emissions was experimentally investigated in an entrained flow reactor (EFR) and an internally circulating fluidized bed (ICFB).
刘典福 +4 more
core +1 more source