Results 51 to 60 of about 130,862 (133)
Clinical Pharmacology &Therapeutics, Volume 116, Issue 2, Page 448-459, August 2024.The global rise in polypharmacy has increased both the necessity and complexity of drug–drug interaction (DDI) assessments, given the growing potential for interactions involving more than two drugs. Leveraging large‐scale healthcare claims data, we piloted a semi‐automated, high‐throughput case‐crossover‐based approach for drug–drug–drug interaction ...
Emily K. Acton +7 more
wiley +1 more source
Environmental Toxicology and Chemistry, Volume 43, Issue 8, Page 1894-1902, August 2024.Abstract Though bioaccumulation of pharmaceuticals by aquatic organisms continues to receive scientific attention, the internal disposition of these contaminants among different tissue compartments of fish species has been infrequently investigated, particularly among fish at different trophic positions. We tested a human to fish biological read‐across
Jaylen L. Sims +8 more
wiley +1 more source
Clinical Pharmacology in Drug Development, Volume 13, Issue 4, Page 367-379, April 2024.Abstract Etripamil, a fast‐acting nondihydropyridine L‐type calcium channel blocker, is under investigation for potential self‐administration for the acute treatment of supraventricular tachyarrhythmias in a medically unsupervised setting. We report detailed pharmacokinetics and pharmacodynamics of intranasally administered etripamil in healthy adults ...
James E. Ip +5 more
wiley +1 more source
Application of 4-chloro-7-nitrobenzofurazan for the analysis of propafenone and diltiazem hydrochlorides using kinetic spectrophotometric and spectrofluorimetric methods [PDF]
, 2013 Several simple, sensitive, accurate and inexpensive spectrophotometric and spectrofluorimetric methods were developed for the determination of propafenone HCl and diltiazem HCl using 4-chloro-7-nitrobenzofurazan (NBD-Cl) accompanied with kinetic study ...
Hosny, Mervat Mohamed +3 more
core +1 more source
FORMULATION PREPARATION AND PHYSICAL CHARACTERISTICS OF CR DILTIAZEM HCL WITH DIFFERENT POLYMER COMBINATIONS [PDF]
, 2017 The drug delivery system (DDS) changes the formulation techniques and have made a great break-through progress. Started a simplest pill formulation and gradually improve the techniques regarding the new symptoms and indications and breakthrough in the ...
Mahira Tabassum, Ghulam Razzaq, Noman ul Haq, Nisar Ahmed, Ghulam Mustafa, Abdul Qadir, Aqeel Nasim
core +1 more source
Polar processing and development of the 2004 Antarctic ozone hole: First results from MLS on Aura [PDF]
, 2005 The Microwave Limb Sounder (MLS) on Aura is providing an extensive data set on stratospheric winter polar processing, including the first daily global observations of HCl, together with simultaneous measurements of ClO, HNO3, H2O, O3, N2O, and ...
Santee, M. L. +9 more
core +1 more source
, 2016 Diltiazem hydrochloride (diltiazem HCl), a calcium channel blocker is widely used in the management of angina pectoris and hypertension. Because of its short biological half-life (3.5 h) and low oral bioavailability (40%) due to extensive hepatic ...
Sholikhah, Aenul +2 more
core
, 2011 The aim of this study was to enhance the release properties of diltiazem hydrochloride (diltiazem HCl) by using microparticle system. For this reason, microparticle drug delivery systems based on chitosan and Eudragit®RSPM were developed.
Kirilmaz, Levent +8 more
core +1 more source
Hcl-1 is expressed in reproductively mature snails.
, 2016 Hcl-1 is only expressed in snails with a size of ≥10 mm. RT-PCR using Hcl-1 specific primers that span four introns (9F: TGATCCAATCTTTTACATTCATCAC, 13R: AAGTTGTCAGCGCTAGTCTCA) yielded an expected amplicon of 757 bp. eIF2α was used as positive control. MW:
Janeth J. Peña (3609611) +1 more
core +1 more source