Results 71 to 80 of about 1,335 (156)

Associação entre Mycoplasma spp. e ácaros do conduto auditivo de bovinos

Pesquisa Veterinária Brasileira, 2012
Esse estudo foi realizado com o objetivo de verificar a associação entre micoplasmas e ácaros (Raillietia auris e R. flechtmanni) no conduto auditivo de bovinos.
Sandra B. dos Santos, Elmiro R. do Nascimento, João Luiz H. Faccini, Maria Lúcia Barreto, Rinaldo A. Mota   +4 more
doaj   +1 more source

The Organization of Cholesterol Esters in Membranes of Mycoplasma capricolum [PDF]

European Journal of Biochemistry, 1981
The organization of cholesterol esters in Mycoplasma capricolum membranes was studied by differential scanning calorimetry. Cells grown in the presence of horse serum incorporated large amounts of cholesterol esters into their membranes. The cholesterolester‐containing membranes after incubation at low temperature showed an endotherm characteristic of ...
D L, Melchior, S, Rottem
openaire   +2 more sources

A whole-genome worldwide molecular epidemiology approach for contagious caprine pleuropneumonia

Heliyon, 2020
Contagious caprine pleuropneumonia is an infectious and contagious disease affecting goats and wildlife ruminants, mostly in Africa and Asia. It is caused by a mycoplasma, Mycoplasma capricolum susbp. capripneumoniae, which is very fastidious.
Etienne Loire, Abdoulkarim Issa Ibrahim, Lucía Manso-Silván, Louis Lignereux, François Thiaucourt   +4 more
doaj   +1 more source

Recherche sur l'origine des fausses réactions positives dans le diagnostic sérologique de la péripneumonie contagieuse bovine

Revue d’Elevage et de Médecine Vétérinaire des Pays Tropicaux, 1989
Des bovins ont été expérimentalement immunisés respectivement avec Mycoplasma (M) capricolum, M. mycoides subsp. mycoides (LC), M. mycoides subsp. capri, M. species groupe 7 de LEACH. Pendant 8 semaines ces animaux ont fait l'objet d'un suivi sérologique
François Poumarat, M. Perrin, P. Belli, D. Longchambon, Christian Le Goff, J.L. Martel   +5 more
doaj   +1 more source

The nucleotide sequence of 5S rRNA from Mycoplasma capricolum [PDF]

Nucleic Acids Research, 1981
The nucleotide sequence of 5S rRNA from Mycoplasma capricolum is UUGGUGGUAUAGCAUAGAGGUCACACCUGUUCCCAUGCCGAACACAGAAGUUAAGCUCUAUUACGGUGAAGAUAUUACU GAUGUGAGAAAAUAGCAAGCUGCCAGUUOH. The length is 107 nucleotides long, and the shortest in all the 5S rRNAs so far known. The sequence is more similar to those of the gram-positive bacteria than those of the gram-
H, Hori, M, Sawada, S, Osawa, K, Murao, H, Ishikura   +4 more
openaire   +2 more sources

Detecção do Grupo Mycoplasma mycoides por imunoperoxidase indireta (IPI) e PCR-REA em conduto auditivo de bovinos Detection of Mycoplasma mycoides cluster by indirect immunoperoxidase (IPI) and PCR-REA in the ear canal of bovines

Pesquisa Veterinária Brasileira, 2010
O Grupo Mycoplasma mycoides (GMM) foi diagnosticado por PCR-REA e imunoperoxidase indireta (IPI) em amostras de lavados de conduto auditivo de bovinos no Estado do Rio de Janeiro, Brasil. 60 bovinos foram selecionados aleatoriamente.
Sandra Batista dos Santos, Elmiro Rosendo do Nascimento, João Luiz Horacio Faccini, Maria Lúcia Barreto, Juliana Ferreira de Almeida, Virginia Léo de Almeida Pereira, Carlos Augusto Martino Campos   +6 more
doaj   +1 more source

Molecular Characterization of Mycoplasma species Isolated From Ruminants Slaughtered at Al-Basateen Slaughterhouse in Egypt [PDF]

Journal of Applied Veterinary Sciences
According to the World Organization for Animal Health, Mycoplasma species have been linked to economically significant diseases that impact ruminants globally, causing serious infections such as contagious bovine pleuropneumonia, contagious caprine ...
Bassma Hasanien, Sahar Ouda, Mahmoud Hashad, Wagih Armaniose   +3 more
doaj   +1 more source

The Secretome of Mycoplasma capricolum subsp. capricolum in Neutral and Acidic Media

Journal of Proteomics & Bioinformatics, 2015
Mycoplasmas have proven to be successful pathogens despite their minimal genomes in some species. Their simplistic nature makes them an important tool for understanding the genes involved in basic metabolic processes and pathogenesis. Of particular interest are the genes involved in mycoplasma evasion of host immune responses and survival within ...
openaire   +1 more source

An exploration of synthetic biology: A preliminary Christian ethical assessment of the advantages and disadvantages of synthetic biology

In die Skriflig, 2014
On 20 May 2010, the Venter Institute in America announced that they have fully synthesised the genome of the organism Mycoplasma mycoides whilst in vitro by using a computer connected to a machine that synthesises genes. Thereafter, the genome was placed
Riaan A.L. Rheeder
doaj   +1 more source

The ribosomal genes of Mycoplasma capricolum.

The Yale journal of biology and medicine, 1984
The nucleotide sequence of 5S rRNA from Mycoplasma capricolum is more similar to that of the gram-positive bacteria than that of the gram-negative bacteria. The presence of two copies of rRNA genes in M. capricolum genome has been demonstrated. The two different rRNA gene clusters have been cloned in E.
A, Muto, H, Hori, M, Sawada, Y, Kawauchi, M, Iwami, F, Yamao, S, Osawa   +6 more
openaire   +1 more source