Cyanobacterial akinete distribution, viability, and cyanotoxin records in sediment archives from the Northern Baltic Sea [PDF]
, 2021 Cyanobacteria of the order Nostocales, including Baltic Sea bloom-forming taxa Nodularia spumigena, Aphanizomenon flosaquae, and Dolichospermum spp., produce resting stages, known as akinetes, under unfavorable conditions.
Akter, Sultana +6 more
core +1 more source
Environmental Microbiology, Volume 25, Issue 12, Page 3319-3332, December 2023., 2023 We explore the previously undescribed diversity of phages associated with anatoxin‐producing benthic mats from rivers, including a novel virulent cyanophage with a ‘jumbo’ genome. This virulent cyanophage is predicted to infect anatoxin‐producing Microcoleus and its appearance is concomitant with the host decline, supporting the kill‐the‐winner ...
Cecilio Valadez‐Cano +2 more
wiley +1 more source
Aptamers as the Agent in Decontamination Assays (Apta-Decontamination Assays): From the Environment to the Potential Application In Vivo [PDF]
, 2017 The binding specificity and affinity of aptamers have long been harnessed as the key elements in the development of aptamerbased assays, particularly aptasensing application.
Citartan, Marimuthu +4 more
core +1 more source
Biological Reviews, Volume 98, Issue 5, Page 1712-1731, October 2023., 2023 ABSTRACT Nitrogen (N) deposition has increased substantially since the second half of the 20th century due to human activities. This increase of reactive N into the biosphere has major implications for ecosystem functioning, including primary production, soil and water chemistry and producer community structure and diversity.
Joost J. Vogels +8 more
wiley +1 more source
Evaluation of direct sample injection as a fast, no-sample handling, approach for the LC-MS/MS monitoring of pharmaceuticals in different water matrices [PDF]
, 2023 The determination of drug residues in water, particularly in environmental water, is a hot topic due to the usual presence of these emerging contaminants in the aquatic environment and their potential negative impact on water quality.
Garlito Molina, Borja +3 more
core +1 more source
PLoS ONE, 2020 The aim of this study was to investigate the potential interference of cyanobacterial metabolites, in particular microcystins (MCs), with steroid hormone biosynthesis. Steroid hormones control many fundamental processes in an organism, thus alteration of
Vittoria Mallia +6 more
doaj +1 more source
A feasibility study into the production of a mussel matrix reference material for the cyanobacterial toxins microcystins and nodularins. [PDF]
, 2022 Microcystins and nodularins, produced naturally by certain species of cyanobacteria, have been found to accumulate in aquatic foodstuffs such as fish and shellfish, resulting in a risk to the health of the seafood consumer.
Beach, Daniel G. +10 more
core +2 more sources
MALDI imaging mass spectrometry of fresh water cyanobacteria: spatial distribution of toxins and other metabolites [PDF]
, 2017 Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP)Conselho Nacional de Desenvolvimento Científico e Tecnológico (CNPq)Coordenação de Aperfeiçoamento de Pessoal de Nível Superior (CAPES)Cyanobacteria are among the most ancient forms of life ...
Bronzel Jr. João L. +5 more
core +1 more source
Impedimetric microcystin-lr aptasensor prepared with sulfonated poly(2,5-dimethoxyaniline)–silver nanocomposite [PDF]
, 2021 This paper presents a novel impedimetric aptasensor for cyanobacterial microcystin-LR (L, L-leucine; R, L-arginine) (MC-LR) containing a 50 thiolated 60-mer DNA aptamer (i.e., 50 -SH- (CH2 )6GGCGCCAAACAGGACCACCATGACAATTACCCATACCACCTCATTATGCCCCATCT ...
Bilibana, Mawethu Pascoe +2 more
core +1 more source
Review of cyanotoxicity studies based on cell cultures [PDF]
, 2022 Cyanotoxins (CTs) are a large and diverse group of toxins produced by the peculiar photosynthetic prokaryotes of the domain Cyanoprokaryota. Toxin-producing aquatic cyanoprokaryotes can develop in mass, causing “water blooms” or “cyanoblooms,” which may ...
Chichova, Mariela +8 more
core +1 more source