Results 101 to 110 of about 26,439 (217)

Patterns and regulation of ribosomal RNA transcription in Borrelia burgdorferi

open access: yesBMC Microbiology, 2011
Background Borrelia burgdorferi contains one 16S and two tandem sets of 23S-5S ribosomal (r) RNA genes whose patterns of transcription and regulation are unknown but are likely to be critical for survival and persistence in its hosts. Results RT-PCR of B.
Schwartz Ira   +3 more
doaj   +1 more source

Reduced ribosomal RNA expression and unchanged ribosomal DNA promoter methylation in oral squamous cell carcinoma

open access: yesMolecular Genetics & Genomic Medicine, 2019
Background Ribosomal RNA (rRNA) consists of four non‐coding RNAs, the 28S, 5.8S, 18S, and 5S rRNA. Abnormal expression of rRNA has been found in multiple tumors, and the methylation of rDNA promoter may affect rRNA expression as an epigenetic regulatory ...
Shanshan Ha   +4 more
doaj   +1 more source

Conservation and loss of ribosomal RNA gene sites in diploid and polyploid Fragaria (Rosaceae)

open access: yesBMC Plant Biology, 2011
Background The genus Fragaria comprises species at ploidy levels ranging from diploid (2n = 2x = 14) to decaploid (2n = 10x = 70). Fluorescence in situ hybridization with 5S and 25S rDNA probes was performed to gather cytogenetic information that ...
Liu Bo, Davis Thomas M
doaj   +1 more source

The 5S ribosomal RNA gene of Euplotes

open access: yes, 1988
A library of Euplotes eurystomus macronuclear DNA was constructed in the pUC plasmid vector and cloned in E. coli. Screening of the library with the 5S ribosomal RNA gene of Tetrahymena thermophila resulted in 19 apparently identical isolates of the ...
Roberson, Arthur E.
core  

Genome-wide distribution of RNA-DNA hybrids identifies RNase H targets in tRNA genes, retrotransposons and mitochondria.

open access: yesPLoS Genetics, 2014
During transcription, the nascent RNA can invade the DNA template, forming extended RNA-DNA duplexes (R-loops). Here we employ ChIP-seq in strains expressing or lacking RNase H to map targets of RNase H activity throughout the budding yeast genome.
Aziz El Hage   +3 more
doaj   +1 more source

Nucleotide sequence and structure of cytoplasmic 5S RNA and 5.8S RNA of Chlamydomonas reinhardii

open access: yes, 1981
Three small RNAs of the cytoplasmic 8OS ribosomes of the green unicellular alga Chlamydomonas reinhardii have been sequenced. They include two species of ribosomal 5S RNA, a major and a minor one of 122 and 121 nucleotides respectively, which differ from
Rochaix, Jean-David, Darlix, Jean-Luc
core   +1 more source

Evaluation of RNA extraction methods in rice and their application in expression analysis of resistance genes against Magnaporthe oryzae

open access: yesBiotechnology & Biotechnological Equipment, 2017
Extraction of RNA of high quality and integrity is essential for gene expression studies and all downstream RNA-based techniques. The leaves of 16 merit Malaysian rice varieties were used to isolate total RNA using five different methods.
Parisa Azizi   +7 more
doaj   +1 more source

Antileishmanial and antitrypanosomal activities of the 8-aminoquinoline tafenoquine.

open access: yes, 2010
The 8-aminoquinoline tafenoquine showed significant in vitro activity against Leishmania species, including L. donovani amastigotes in macrophages, with 50% inhibitory concentrations (IC(50)s) between 0.1 and 4.0 μM for both pentavalent antimony (SbV ...
Croft, Simon L   +5 more
core   +1 more source

Unusual structural features of the 5S ribosomal RNA from Streptococcus cremoris

open access: yes, 1983
The nucleotide sequence of the 5S ribosomal RNA of Streptococcus cremoris has been determined. The sequence is 5 ' UUUUGGUCAUCAUUGCGAUGGAGAUACACCUGUUCCCAUGUCGAACACAGAAGUUAAGUCC AOCOACGGCGGAAGOACUUGGGGGUOGCCCCCUGGGAGAUAOGCGAGUGGCCAAGUOH 3&apos ...
Nicholas Ddihas   +2 more
core  

Evolution of green plants and their relationship with other photosynthetic eukaryotes as deduced from 5S ribosomal RNA sequences

open access: yes, 1990
The nucleotide sequence of cytoplasmic 5S ribosomal RNAs from three gymnosperms, Pinus contorta, Taxus baccata and Juniperus media and from one fern, Pteridium aquilinum, have been determined.
De Wachter, Rupert   +3 more
core   +1 more source

Home - About - Disclaimer - Privacy