Results 101 to 110 of about 26,439 (217)
Patterns and regulation of ribosomal RNA transcription in
BMC Microbiology, 2011 Background Borrelia burgdorferi contains one 16S and two tandem sets of 23S-5S ribosomal (r) RNA genes whose patterns of transcription and regulation are unknown but are likely to be critical for survival and persistence in its hosts. Results RT-PCR of B.
Schwartz Ira +3 more
doaj +1 more source
Molecular Genetics & Genomic Medicine, 2019 Background Ribosomal RNA (rRNA) consists of four non‐coding RNAs, the 28S, 5.8S, 18S, and 5S rRNA. Abnormal expression of rRNA has been found in multiple tumors, and the methylation of rDNA promoter may affect rRNA expression as an epigenetic regulatory ...
Shanshan Ha +4 more
doaj +1 more source
Conservation and loss of ribosomal RNA gene sites in diploid and polyploid
BMC Plant Biology, 2011 Background The genus Fragaria comprises species at ploidy levels ranging from diploid (2n = 2x = 14) to decaploid (2n = 10x = 70). Fluorescence in situ hybridization with 5S and 25S rDNA probes was performed to gather cytogenetic information that ...
Liu Bo, Davis Thomas M
doaj +1 more source
The 5S ribosomal RNA gene of Euplotes
, 1988 A library of Euplotes eurystomus macronuclear DNA was constructed in the pUC plasmid vector and cloned in E. coli. Screening of the library with the 5S ribosomal RNA gene of Tetrahymena thermophila resulted in 19 apparently identical isolates of the ...
Roberson, Arthur E.
core
PLoS Genetics, 2014 During transcription, the nascent RNA can invade the DNA template, forming extended RNA-DNA duplexes (R-loops). Here we employ ChIP-seq in strains expressing or lacking RNase H to map targets of RNase H activity throughout the budding yeast genome.
Aziz El Hage +3 more
doaj +1 more source
Nucleotide sequence and structure of cytoplasmic 5S RNA and 5.8S RNA of Chlamydomonas reinhardii
, 1981 Three small RNAs of the cytoplasmic 8OS ribosomes of the green unicellular alga Chlamydomonas reinhardii have been sequenced. They include two species of ribosomal 5S RNA, a major and a minor one of 122 and 121 nucleotides respectively, which differ from
Rochaix, Jean-David, Darlix, Jean-Luc
core +1 more source
Biotechnology & Biotechnological Equipment, 2017 Extraction of RNA of high quality and integrity is essential for gene expression studies and all downstream RNA-based techniques. The leaves of 16 merit Malaysian rice varieties were used to isolate total RNA using five different methods.
Parisa Azizi +7 more
doaj +1 more source
Antileishmanial and antitrypanosomal activities of the 8-aminoquinoline tafenoquine.
, 2010 The 8-aminoquinoline tafenoquine showed significant in vitro activity against Leishmania species, including L. donovani amastigotes in macrophages, with 50% inhibitory concentrations (IC(50)s) between 0.1 and 4.0 μM for both pentavalent antimony (SbV ...
Croft, Simon L +5 more
core +1 more source
Unusual structural features of the 5S ribosomal RNA from Streptococcus cremoris
, 1983 The nucleotide sequence of the 5S ribosomal RNA of Streptococcus cremoris has been determined. The sequence is 5 ' UUUUGGUCAUCAUUGCGAUGGAGAUACACCUGUUCCCAUGUCGAACACAGAAGUUAAGUCC AOCOACGGCGGAAGOACUUGGGGGUOGCCCCCUGGGAGAUAOGCGAGUGGCCAAGUOH 3&apos ...
Nicholas Ddihas +2 more
core
, 1990 The nucleotide sequence of cytoplasmic 5S ribosomal RNAs from three gymnosperms, Pinus contorta, Taxus baccata and Juniperus media and from one fern, Pteridium aquilinum, have been determined.
De Wachter, Rupert +3 more
core +1 more source