Results 111 to 120 of about 26,439 (217)

Pruning the Tree: Comparing OTUs and ASVs in High‐Throughput Sequencing of 5S‐IGS Nuclear Ribosomal DNA in Phylogenetic Studies

Ecology and Evolution
Amplicon sequencing of the nuclear ribosomal 5S RNA gene arrays is highly promising for genotaxonomy, to delineate genetic resources of species and trace their evolution.
Simone Cardoni, Roberta Piredda, Guido W. Grimm, Mariangela Santorsola, Ernst‐Detlef Schulze, Thomas Denk, Daniele De Luca, Marco Cosimo Simeone   +7 more
doaj   +1 more source

Therapeutic glucocorticoid-induced TNF receptor-mediated amplification of CD4+ T cell responses enhances antiparasitic immunity.

, 2010
Chronic infectious diseases and cancers are often associated with suboptimal effector T cell responses. Enhancement of T cell costimulatory signals has been extensively studied for cancer immunotherapy but not so for the treatment of infectious disease ...
Hill, Geoffrey R, Sakaguchi, Shimon, Haque, Ashraful, Stanley, Amanda C., Stanley, Amanda C, Zhou, Yonghong, Kuns, Rachel D, Amante, Fiona H., Rivera, Fabian de Labastida, Yardley, Vanessa, Kuns, Rachel D., Engwerda, Christian R, de Labastida Rivera, Fabian, Engwerda, Christian R., Amante, Fiona H, Hill, Geoffrey R.   +15 more
core   +1 more source

Structures of complexes of 5S RNA with ribosomal proteins L5, L18 and L25 from Escherichia coli:Identification of kethoxal-reactive sites on the 5S RNA

, 1979
The topography of Escherichia coli 5S RNA has been examined in the presence of ribosomal proteins L5, L18 and L25 and their different combinations, by comparing the kethoxal modification characteristics of the various RNA-protein complexes with those of ...
Garrett, Roger A., Noller, Harry F.
core   +1 more source

The 5S ribosomal RNA of Euglena gracilis cytoplasmic ribosomes is closely homologous to the 5S RNA of the trypanosomatid protozoa.

Nucleic acids research, 1982
The complete nucleotide sequence of the major species of cytoplasmic 5S ribosomal RNA of Euglena gracilis has been determined. The sequence is: 5' GGCGUACGGCCAUACUACCGGGAAUACACCUGAACCCGUUCGAUUUCAGAAGUUAAGCCUGGUCAGGCCCAGUUAGUAC UGAGGUGGGCGACCACUUGGGAACACUGGGUGCUGUACGCUUOH3'.
N, Delihas, J, Andersen, W, Andresini, L, Kaufman, H, Lyman   +4 more
openaire   +1 more source

Activity of anti-cancer protein kinase inhibitors against Leishmania spp.

, 2014
OBJECTIVES: There is an urgent need to develop new and effective treatments for poverty-related neglected diseases. In light of the time required to bring a new drug to market and the cost involved (10-15 years, >1 billion US$), one approach to ...
Croft, Simon L, Sanderson, Lisa, Yardley, Vanessa   +2 more
core   +1 more source

The reaction of 5S RNA in 70S ribosomes with kethoxal [PDF]

FEBS Letters, 1975
Delihas, N., Dunn, J.J., Erdmann, V.A.
openaire   +2 more sources

Studies on protein-nucleic acid interactions in Xenopus laevis oocyte 5S ribosomal RNA gene expression

, 2018
The experiments were focussed on three protein-nucleic acid interactions in the Xenopus oocyte: TFIIIA-5S RNA, TFIIIA-5S DNA and ribosomal protein L5-5S RNA. The binding affinities and contact sites of the proteins to the nucleic acids were studied. For
You, Qimin
core   +1 more source

Synthesis and evaluation of phenylequine for antimalarial activity in vitro and in vivo.

, 2010
Synthesis of the potent antiplasmodial 4-aminoquinoline, phenylequine (PQ), is reported for the first time. PQ and the two analogues show increased efficacy in moving from the chloroquine sensitive D10 to the chloroquine resistant K1 strain in vitro. The
Yardley, Vanessa, Chibale, Kelly, Blackie, Margaret AL   +2 more
core   +1 more source

The effect of genes on A and B chromosomes of a number of Triticinae on meiotic behaviour in Triticum aestivum and its hybrids with related species

, 1979
Results obtained and hypotheses that have been put forward to integrate them, are summarized in this section.1. Studies of chromosome association in F 1 hybrids Triticum aestivum X Secale cereale with and without chromosome 5B and in the presence or in ...
Viegas, W.S.
core  

Reversed chloroquines based on the 3,4-dihydropyrimidin-2(1H)-one scaffold: synthesis and evaluation for antimalarial, beta-haematin inhibition, and cytotoxic activity.

, 2008
(Chemical Equation Presented) The synthesis, cytotoxicity, and antimalarial activity of resistance-reversing bifunctional dihydropyrimidone-chloroquinoline conjugates are reported herein.
Ncokazi, Kanyile, Nicholas D. Watermeyer, Timothy J. Egan, Vanessa Yardley, Natasha October, Kelly Chibale, Yardley, Vanessa, Kanyile Ncokazi, Chibale, Kelly, October, Natasha, Egan, Timothy J, Watermeyer, Nicholas D   +11 more
core   +1 more source