Results 31 to 40 of about 86,320 (269)
A new RNA-RNA crosslinking reagent and its application to ribosomal 5S RNA.
Nucleic Acids Research, 1978 The synthesis of a new RNA specific bifunctional crosslinking reagent, 1.4-phenyl-diglyoxal, is described which reacts exclusively with guanosines. The properties of the crosslinked products enabled us to develop a straightforward method for identifying ...
R. Wagner, R. Garrett
semanticscholar +1 more source
Expansion segments in bacterial and archaeal 5S ribosomal RNAs [PDF]
RNA, 2020 The large ribosomal RNAs of eukaryotes frequently contain expansion sequences that add to the size of the rRNAs but do not affect their overall structural layout and are compatible with major ribosomal function as an mRNA translation machine. The expansion of prokaryotic ribosomal RNAs is much less explored.
Victor G. Stepanov, George E. Fox
openaire +4 more sources
BMC Ecology and Evolution, 2021 Background Autotetraploid Carassius auratus (4n = 200, RRRR) (abbreviated as 4nRR) is derived from whole genome duplication of Carassius auratus red var. (2n = 100, RR) (abbreviated as RCC).
Chun Zhao +10 more
doaj +1 more source
Two thraustochytrid 5S ribosomal RNAs
Nucleic Acids Research, 1982 The complete nucleotide sequences of the 5S ribosomal RNAs (rRNAs) of two thraustochytrids, Thraustochytrium visurgense and Schizochytrium, aggregatum, are AUGAGCCCUCAUAUCAUGUGGAGUGCACCGGAUCUCAUCCGAACUCCGUAGUUAAGCCACAUAGAGCGCGUC UAGUACUGCCGUAGGGGACUAGGUGGGAAGCACGCGUGGGGCUCAUU and ACAGCCGUUCAUACCACACGGAGA ...
W. Ford Doolittle, Ron M. MacKay
openaire +4 more sources
Evolutionary Dynamics of Multigene Families in Triportheus (Characiformes, Triportheidae): A Transposon Mediated Mechanism? [PDF]
, 2020 Triportheus (Characiformes, Triportheidae) is a freshwater fish genus with 18 valid species. These fishes are widely distributed in the major river drainages of South America, having commercial importance in the fishing market, mainly in the Amazon basin.
Bertollo, Luiz A. C. +6 more
core +2 more sources
Amplification and adaptation of centromeric repeats in polyploid switchgrass species. [PDF]
, 2018 Centromeres in most higher eukaryotes are composed of long arrays of satellite repeats from a single satellite repeat family. Why centromeres are dominated by a single satellite repeat and how the satellite repeats originate and evolve are among the most
Braz, Guilherme T +10 more
core +2 more sources
Traffic of interacting ribosomes: effects of single-machine mechano-chemistry on protein synthesis [PDF]
Physical Review E 75, 021902 (2007), 2006 Many ribosomes simultaneously move on the same messenger RNA (mRNA), each separately synthesizing the protein coded by the mRNA. Earlier models of ribosome traffic represent each ribosome by a ``self-propelled particle'' and capture the dynamics by an extension of the totally asymmetric simple exclusion process (TASEP).
arxiv +2 more sources
Haematologica, 2010 Background Diamond-Blackfan anemia and Shwachman-Diamond syndrome are inherited bone marrow failure syndromes linked to defects in ribosome synthesis.
Joseph B. Moore +4 more
doaj +1 more source
Evolutionary changes in the higher order structure of the ribosomal 5S RNA
Nucleic Acids Res., 1987 Comparative studies have been undertaken on the higher order structure of ribosomal 5S RNAs from diverse origins. Competitive reassociation studies show that 5S RNA from either a eukaryote or archaebacterium will form a stable ribonucleoprotein complex ...
J. McDougall, R. Nazar
semanticscholar +1 more source
Nucleic Acids Research, 1999 This paper presents the updated version of the data base of ribosomal 5S ribonucleic acids (5S rRNA) and their genes (5S rDNA). This edition of the data bank contains 1889 primary structures of 5S rRNA and 5S rDNA. These include 60 archaebacterial, 439 eubacterial, 63 plastid, 9 mitochondrial and 1318 eukaryotic sequences.
Maciej Szymanski +3 more
openaire +4 more sources