Results 91 to 100 of about 177,651 (293)
ULTRA-effective labeling of tandem repeats in genomic sequence
Bioinformatics AdvancesAbstract In the age of long read sequencing, genomics researchers now have access to accurate repetitive DNA sequence (including satellites) that, due to the limitations of short read-sequencing, could previously be observed only as unmappable fragments.
Daniel R Olson, Travis J Wheeler
openaire +2 more sources
Somatic mutational landscape in von Hippel–Lindau familial hemangioblastoma
Molecular Oncology, EarlyView.The causes of central nervous system (CNS) hemangioblastoma in Von Hippel–Lindau (vHL) disease are unclear. We used Whole Exome Sequencing (WES) on familial hemangioblastoma to investigate events that underlie tumor development. Our findings suggest that VHL loss creates a permissive environment for tumor formation, while additional alterations ...
Maja Dembic +5 more
wiley +1 more source
Molecular Oncology, EarlyView.Beyond its role in immune evasion, this study identified that CD47 drives tumor‐intrinsic signaling in non‐small cell lung cancer (NSCLC). Transcriptomic profiling and functional studies revealed that CD47 regulates cell adhesion, migration, and metastasis through an ERK–EMT signaling axis.
Asa P.Y. Lau +8 more
wiley +1 more source
Development of Multi-Locus Variable Number Tandem Repeat Analysis for Outbreak Detection of Neisseria meningitidis [PDF]
, 2006 Neisseria meningitidis is a major cause of septicemia and meningitis worldwide. Traditional typing methods like pulsed-field gel electrophoresis (PFGE) for identifying outbreaks are subjective and time consuming.
Price, Alicia Anne
core
Protein Repeats from First Principles [PDF]
, 2016 Some natural proteins display recurrent structural patterns. Despite being highly similar at the tertiary structure level, repeating patterns within a single repeat protein can be extremely variable at the sequence level. We use a mathematical definition
Becher, Veronica Andrea +4 more
core +1 more source
Molecular Oncology, EarlyView.CIN85 is highly expressed in osteosarcoma, particularly in metastatic lesions. Its overexpression increases cell migration and Matrigel invasion, while silencing CIN85 suppresses these behaviors. Transcriptome analysis shows that CIN85 regulates MMP2, COL3A1, and Akt/mTOR signaling. Targeting these pathways reverses CIN85‐induced motility, highlighting
Iryna Horak +10 more
wiley +1 more source
Genetics and Molecular Biology, 2000 The present study is a revision of our work on evolutionary cytogenetics of the genus Zea, including several new experiments which give a deeper insight into the nature of the DNA sequences involved in telomeric regions of Zea luxurians.
Lidia Poggio +4 more
doaj +1 more source
A Dynamic Programming Approach to De Novo Peptide Sequencing via Tandem Mass Spectrometry [PDF]
, 2001 The tandem mass spectrometry fragments a large number of molecules of the same peptide sequence into charged prefix and suffix subsequences, and then measures mass/charge ratios of these ions.
Chen, Ting +4 more
core +3 more sources
Amplification and sequencing of Short Tandem Repeats v1
, 2019 To depict the variability among strains 2 STRs viz., GT6 and TA11CA3 region were amplified. All PCR reactions were carried out in 50μl total volume with 100 pmol of each primer and approximately 20 ng of template DNA. PCR reactions were performed on a Master cycler gradient using the primers 5’CCTATCGATCTATGGCTTCC3’ (forward) and 5 ...
Partha Sarathi Mohanty +7 more
openaire +1 more source
Molecular Oncology, EarlyView.Ixazomib inhibits proteasome‐mediated degradation of topoisomerase I induced by irinotecan, thereby restoring drug sensitivity and promoting tumor cell death in colorectal cancer. Irinotecan, a topoisomerase I (topoI) inhibitor, is widely used for colorectal cancer, but resistance remains a major clinical challenge.
Yuho Ebata +10 more
wiley +1 more source