Results 111 to 120 of about 253,337 (321)

Characterization of repeat arrays in ultra‐long nanopore reads reveals frequent origin of satellite DNA from retrotransposon‐derived tandem repeats

The Plant Journal, 2019
Summary Amplification of monomer sequences into long contiguous arrays is the main feature distinguishing satellite DNA from other tandem repeats, yet it is also the main obstacle in its investigation because these arrays are in principle difficult to ...
Tihana Vondrak, Laura Ávila Robledillo, P. Novák, A. Koblížková, P. Neumann, J. Macas   +5 more
semanticscholar   +1 more source

Remarkable stability of an instability-prone lentiviral vector plasmid in Escherichia coli Stbl3 [PDF]

, 2013
04.11.13 KB.
Mehmet, H, Zambetti, LP, Tchetchelnitski, V, Al-Allaf, FA, Tolmachov, OE   +4 more
core   +1 more source

Optimizing photoactivation of PA‐mCherry for optical pooled CRISPR screens

FEBS Open Bio, EarlyView.
Photoactivatable PA‐mCherry finds widespread use to optically tag individual cells. However, confocal 405 nm UV laser‐scanning (normal scan) is much less efficient than widefield UV illumination, limiting the use of PA‐mCherry on confocal instruments. We remedy this limitation by reporting that rapid and repeated confocal scanning with a low‐intensity,
Sravasti Mukherjee, Giulia Zanetti, Bram van den Broek, Kees Jalink   +3 more
wiley   +1 more source

Profiling of Short-Tandem-Repeat Disease Alleles in 12,632 Human Whole Genomes

American Journal of Human Genetics, 2017
Short tandem repeats (STRs) are hyper-mutable sequences in the human genome. They are often used in forensics and population genetics and are also the underlying cause of many genetic diseases.
Haibao Tang, E. Kirkness, Christoph Lippert, W. Biggs, Martin M. Fabani, Ernesto Guzmán, Smriti R. Ramakrishnan, V. Lavrenko, Boyko Kakaradov, Claire Hou, B. Hicks, D. Heckerman, F. Och, C. Caskey, J. Venter, A. Telenti   +15 more
semanticscholar   +1 more source

Summary of the variation within the tandem repeat domains.

, 2014
Deduced amino acid sequences from the tandem repeat regions of genomic DNA sequences are shown. For each subfamily, the motifs present in the tandem repeat domain are shown along with their average copy number, position and consensus sequence. For Gp-hyp-
Peter E. Urwin (183000), Catherine J. Lilley (182995), Sebastian Eves-van den Akker (515790), John T. Jones (207247)   +3 more
core   +1 more source

Amplification and sequencing of Short Tandem Repeats v1

, 2019
To depict the variability among strains 2 STRs viz., GT6 and TA11CA3 region were amplified. All PCR reactions were carried out in 50μl total volume with 100 pmol of each primer and approximately 20 ng of template DNA. PCR reactions were performed on a Master cycler gradient using the primers 5’CCTATCGATCTATGGCTTCC3’ (forward) and 5 ...
Partha Sarathi Mohanty, Avi Kumar Bansal, Farah Naaz, Mamta Arora, Umesh Datta Gupta, Pushpa Gupta, Sandeep Sharma, Haribhan Singh   +7 more
openaire   +1 more source

Small RNA pathways in mammalian oocytes

FEBS Open Bio, EarlyView.
Three distinct small RNA pathways operate in mammalian oocytes: RNAi interference (RNAi), the microRNA (miRNA) pathway, and the PIWI‐associated RNA (piRNA) pathway. These pathways use small RNAs to guide sequence‐specific repression and contribute to oocyte biology by targeting genes and mobile elements or appear insignificant since different ...
Petr Svoboda, Josef Pasulka
wiley   +1 more source

FISH mapping and molecular organization of the major repetitive sequences of tomato

, 2008
This paper presents a bird's-eye view of the major repeats and chromatin types of tomato. Using fluorescence in-situ hybridization (FISH) with Cot-1, Cot-10 and Cot-100 DNA as probes we mapped repetitive sequences of different complexity on pachytene ...
Chang, S.B., Jong, J.H.S.G.M., de, Meznikova, M., Datema, E., Vugt, J., van, Jacobsen, E., Yang, T.J., Kuipers, A., Szinay, D., Klein Lankhorst, R.M., Vosman, B.   +10 more
core   +1 more source

Loss of AMBRA1 activates MAPK and angiogenesis signaling pathways in melanoma cells

FEBS Open Bio, EarlyView.
Loss of AMBRA1 in melanoma cells activates multiple oncogenic pathways associated with tumor progression. Transcriptomic and protein network analyses revealed that AMBRA1 depletion enhances MAPK/ERK signaling, angiogenesis, TGF‐β/EMT signaling, and Wnt/axon guidance pathways.
Milad Ibrahim, Marco Corazzari, Iman Osman, Jane Armstrong, Noel Carter   +4 more
wiley   +1 more source

Plasma EV Proteomics Identifies ECM Remodeling and Inflammatory Proteins LUM and C7 as Candidate Biomarkers in FSHD

Annals of Clinical and Translational Neurology, EarlyView.
ABSTRACT Objective Facioscapulohumeral muscular dystrophy (FSHD) is one of the most debilitating and common muscular dystrophies. Despite its severity, no approved therapy exists for FSHD patients. However, several therapeutic candidates are currently under development, and some have recently entered clinical trials, marking the need for reliable ...
Mustafa Bilal Bayazit, Chiranth K. Nagaraj, Jackson S. Newell, Kim Truc Nguyen, Xilal Y. Rima, Jacob Doon‐Ralls, Eduardo Reátegui, Jeffrey M. Statland, Rabi Tawil, Kevin M. Flanigan, Scott Q. Harper, Nizar Y. Saad   +11 more
wiley   +1 more source