Results 91 to 100 of about 4,201 (187)

Processive Degradation of Proteins and Other Catalytic Properties of the Proteasome from Thermoplasma acidophilum*

Journal of Biological Chemistry, 1997
Although the structure of the 20 S proteasome from Thermoplasma acidophilum has been elucidated, its enzymatic properties have not been explored in depth.
T. Akopian, A. Kisselev, A. Goldberg
semanticscholar   +1 more source

Nadel im Heuhaufen: Proteinkomplexaufreinigung aus Thermoplasma acidophilum mit einer Phagen-Display-Bibliothek

, 2013
The project aided the discovery of putative protein complexes of Thermoplasma acidophilum by detecting and isolating them with specific antibodies. The phage display library-based gentle protein purification strategy is suitable for providing intact ...
Hubert, Ágnes
core  

Protein complex purification from Thermoplasma acidophilum using a phage display library

, 2014
We developed a novel protein complex isolation method using a single-chain variable fragment (scFv) based phage display library in a two-step purification procedure.
Mitani, Y., Hubert, A., Tamura, T., Nagy, I., Boicu, M.   +4 more
core   +1 more source

Nucleotide sequence of a putative succinate dehydrogenase operon in Thermoplasma acidophilum

, 1993
28 amino acids from the N-terminal region of a putative terminal oxidase from the archaebacterium Thermoplasma acidophilum were determined by Edman degradation.
Reiländer, H., Michel, H. ; https://orcid.org/, Gärtner, P., Lottspeich, F., Bach, M.   +4 more
core   +1 more source

A histone-like protein (HTa) from Thermoplasma acidophilum. II. Complete amino acid sequence.

Journal of Biological Chemistry, 1981
The complete amino acid sequence of the DNA-binding histone-like protein (Hta) from Thermoplasma acidophilum has been established by sequence studies directly on the protein and on tryptic, chymotryptic, and thermolysin peptides derived from the protein.
R. Delange, L. C. Williams, D. Searcy
semanticscholar   +1 more source

Thioredoxin Reductase from Thermoplasma acidophilum: A New Twist on Redox Regulation^,

, 2016
Thioredoxin reductases (TrxRs) regulate the intracellular redox environment by using NADPH to provide reducing equivalents for thioredoxins (Trxs). Here we present the cloning and biochemical characterization of a putative TrxR (Ta0984) and a putative ...
Sean J. Elliott (721232), Catherine L. Drennan (721231), Hector H. Hernandez (2419063), Michael J. Hamill (2419060), Orlando A. Jaquez (2419057)   +4 more
core   +1 more source

Cloning and sequencing of the gene encoding the large (α-) subunit of the proteasome fromThermoplasma acidophilum

, 1991
The gene encoding the α-subunit of the proteasome from Thermoplasma acidophilum was cloned and sequenced. The gene encodes for a polypeptide with 233 amino acid and reduces a calculated molecular weight of 25870. Sequence similarity of the α-subunit with
Burkhardt Dahlmann, Dahlmann, B., Wolfgang Baumeister, Peter Zwickl, Zwickl, P., Baumeister, W., Friedrich Lottspeich, Lottspeich, F.   +7 more
core   +1 more source

Localization of a sequence motif complementary to the nuclear localization signal in proteasomes from Thermoplasma acidophilum by immunoelectron microscopy

, 1992
A sequence motif complementary to the nuclear localization signal (NLS) has been localized in proteasomes from Thermoplasma acidophilum by immunoelectron microscopy using sequence-specific antibodies.
Cejka, Z., Grziwa, A., Dahlmann, B., Santarius, U., Baumeister, W.   +4 more
core   +1 more source

Identification and characterization of Thermoplasma acidophilum glyceraidehyde dehydrogenase: a new class of NADP(+)-specific aldehyde dehydrogenase

, 2018
Thermoacidophilic archaea such as Thermoplasma acidophilum and Sulfolobus solfataricus are known to metabolize D-glucose via the nED (non-phosphorylated Entner-Doudoroff) pathway.
Jung, JH, Lee, SB
core   +1 more source

The nucleotide sequence of the 5S rRNA from the archaebacterium Thermoplasma acidophilum

Nucleic Acids Research, 1981
The complete nucleotide sequence of the 5S ribosomal RNA isolated from the archaebacterium Thermoplasma acidophilum has been determined. The sequence is: pG GCAACGGUCAUAGCAGCAGGGAAACACCAGAUCCCAUUCCGAACUCGACGGUUAAGCCUGCUGCGUAUUGCGUUGUACU GUAUGCCGCGAGGGUACGGGAAGCGCAAUAUGCUGUUACCAC(U)OH.
K R, Luehrsen, G E, Fox, M W, Kilpatrick, R T, Walker, H, Domdey, G, Krupp, H J, Gross   +6 more
openaire   +3 more sources