Results 71 to 80 of about 2,424 (164)

The thermoplasma acidophilum rpl15 gene encodes a homologue of eukaryotic ribosomal proteins l15/yl10

, 1995
A gene has been cloned from the archaebacterium, Thermoplasma acidophilum, which, on the basis of the deduced amino acid sequence, encodes a homologue of the eukaryotic large subunit ribosomal proteins, L15/YL10.
Zwickl, P., Lupas, A., Baumeister, W.
core   +1 more source

The thermosome - alternating alpha and beta-subunits within the chaperonin of the archaeon thermoplasma acidophilum

, 1997
The thermosome of the archaeon Thermoplasma acidophilum is composed of two subunits, alpha and beta, which are arranged in two stacked, eight-membered rings.
Nitsch, M., Lupas, A. ; https://orcid.org/, Nitsch, N., Lupas, A., Baumeister, W., Klumpp, M.   +5 more
core   +1 more source

Citrate synthase from the thermophilic archaebacteria Thermoplasma acidophilum and Sulfolobus acidocaldarius

, 1987
Citrate synthase has been purified to homogeneity from the thermophilic archaebacteria Thermoplasma acidophilum and Sulfolobus acidocaldarius. From the relative molecular masses of the native proteins (85 and 83 kDa, respectively) and of their ...
Kenneth J. Stevenson, Leon D. Smith, David W. Hough, Hough, David W., Stevenson, Kenneth J., Michael J. Danson, Smith, Leon D., Danson, Michael J.   +7 more
core   +1 more source

Protein complex purification from Thermoplasma acidophilum using a phage display library

, 2014
We developed a novel protein complex isolation method using a single-chain variable fragment (scFv) based phage display library in a two-step purification procedure.
Mitani, Y., Hubert, A., Tamura, T., Nagy, I., Boicu, M.   +4 more
core   +1 more source

Lipoprotein-like particles in a prokaryote: quinone droplets of Thermoplasma acidophilum

, 2016
Cytosolic, globular droplets with an average diameter of 50 nm were observed in vitrified Thermoplasma acidophilum cells by means of cryo-electron tomography.
Orsini, M., Moracci, Marco, Varga, Sándor, Nagy, I., Boicu, M., Baumeister, W., Orsini, Massimiliano, Kukolya, J., Kofler, C., Weyher-Stingl, Elisabeth, Sun, N., Fernández Busnadiego, Rubén, Weyher-Stingl, E., Varga, S., Kofler, Christine, Nagy, István, Kukolya, József, Fernandez-Busnadiego, R., Nickell, S., Knispel, R., Sun, Na, Boicu, Marius, Knispel, Roland Wilhelm   +22 more
core   +1 more source

Organization of rRNA structural genes in the archaebacteriumThermoplasma acidophilum

Nucleic Acids Research, 1982
In the archaebacterium Thermoplasma acidophilum, each of the structural genes for 5S, 16S and 23S rRNA occur once per genome. In contrast to those of eubacteria and eukaryotes, they appear unlinked. The distance between the 16S and the 23S rDNA is at least 7.5 Kb, that between 23S and 5S rDNA at least 6 Kb and that between 16S and 5S rDNA at least 1.5 ...
J, Tu, W, Zillig
openaire   +3 more sources

Nadel im Heuhaufen: Proteinkomplexaufreinigung aus Thermoplasma acidophilum mit einer Phagen-Display-Bibliothek

, 2013
The project aided the discovery of putative protein complexes of Thermoplasma acidophilum by detecting and isolating them with specific antibodies. The phage display library-based gentle protein purification strategy is suitable for providing intact ...
Hubert, Ágnes
core  

Localization of subunits in proteasomes from Thermoplasma acidophilum by immunoelectron microscopy

, 1991
The subunit topography of the Thermoplasma acidophilum proteasome was determined by immunoelectron microscopy using monospecific antibodies directed against the two constituent subunits (alpha,beta).
Burkhardt Dahlmann, Grziwa, Anja, Baumeister, Wolfgang, Grziwa, A., Dahlmann, B., Kopp, Friedrich, Anja Grziwa, Wolfgang Baumeister, Baumeister, W., Kopp, F., Friedrich Kopp, Dahlmann, Burkhardt   +11 more
core   +1 more source

The Intein of the Thermoplasma A-ATPase A Subunit: Structure, Evolution and Expression in E. Coli

, 2001
Inteins are selfish genetic elements that excise themselves from the host protein during post translational processing, and religate the host protein with a peptide bond.
Alireza G Senejani, Senejani, Ali, Gogarten, J. Peter, Hilario, Elena, J Peter Gogarten, Elena Hilario   +5 more
core   +1 more source

The nucleotide sequence of the 5S rRNA from the archaebacterium Thermoplasma acidophilum

Nucleic Acids Research, 1981
The complete nucleotide sequence of the 5S ribosomal RNA isolated from the archaebacterium Thermoplasma acidophilum has been determined. The sequence is: pG GCAACGGUCAUAGCAGCAGGGAAACACCAGAUCCCAUUCCGAACUCGACGGUUAAGCCUGCUGCGUAUUGCGUUGUACU GUAUGCCGCGAGGGUACGGGAAGCGCAAUAUGCUGUUACCAC(U)OH.
K R, Luehrsen, G E, Fox, M W, Kilpatrick, R T, Walker, H, Domdey, G, Krupp, H J, Gross   +6 more
openaire   +3 more sources