The nucleotide sequence of the 5S rRNA from the archaebacterium Thermoplasma acidophilum
Nucleic Acids Research, 1981 The complete nucleotide sequence of the 5S ribosomal RNA isolated from the archaebacterium Thermoplasma acidophilum has been determined. The sequence is: pG GCAACGGUCAUAGCAGCAGGGAAACACCAGAUCCCAUUCCGAACUCGACGGUUAAGCCUGCUGCGUAUUGCGUUGUACU GUAUGCCGCGAGGGUACGGGAAGCGCAAUAUGCUGUUACCAC(U)OH.
K R, Luehrsen +6 more
openaire +3 more sources
The Cytochromes of Thermoplasma acidophilum [PDF]
Journal of General Microbiology, 1978 openaire +1 more source
Exploring long-range cooperativity in the 20S proteasome core particle from Thermoplasma acidophilum using methyl-TROSY-based NMR. [PDF]
Proc Natl Acad Sci U S A, 2020 Rennella E, Huang R, Yu Z, Kay LE.
europepmc +1 more source
On the damage done to the structure of the Thermoplasma acidophilum proteasome by electron radiation. [PDF]
Protein Sci, 2018 Wang J +4 more
europepmc +1 more source
Probing the cooperativity of Thermoplasma acidophilum proteasome core particle gating by NMR spectroscopy. [PDF]
Proc Natl Acad Sci U S A, 2017 Huang R, Pérez F, Kay LE.
europepmc +1 more source
Crystal structure of (S)-3-O-geranylgeranylglyceryl phosphate synthase from Thermoplasma acidophilum in complex with the substrate sn-glycerol 1-phosphate. [PDF]
Acta Crystallogr F Struct Biol Commun, 2019 Nemoto N +3 more
europepmc +1 more source
Crystallization behaviour of glyceraldehyde dehydrogenase from Thermoplasma acidophilum. [PDF]
Acta Crystallogr F Struct Biol Commun, 2015 Iermak I +4 more
europepmc +1 more source
A new crystal form of the DNA-free full-length XPD helicase from Thermoplasma acidophilum. [PDF]
Acta Crystallogr F Struct Biol CommunBravo M, Fan L.
europepmc +1 more source
The Functional State of <i>Thermoplasma acidophilum</i> Pyruvate Kinase Relies on an Extra Carboxyl-Terminal Sequence. [PDF]
Int J Mol SciRamírez-Silva L +7 more
europepmc +1 more source