Results 81 to 90 of about 943 (189)

Occurrence of Prunus necrotic ringspot virus on nectarine (Prunus persica) in India

, 2008
This paper presents the results of the first survey for Prunus necrotic ringspot virus (PNRSV) on nectarine ( Prunus persica) in India, where stone fruits are grown on a commercial scale. Using basic diagnostic techniques such as ELISA and RT-PCR, the
Rana, T, Hallan, Vipin, Chandel, V, Zaidi, A A   +3 more
core  

Commodity risk assessment of plants of 12 selected Prunus species from Moldova

EFSA Journal, Volume 22, Issue 3, March 2024.
Abstract The European Commission requested the EFSA Panel on Plant Health to prepare and deliver risk assessments for commodities listed in Commission Implementing Regulation (EU) 2018/2019 as ‘High‐risk plants, plant products and other objects’. This Scientific Opinion covers plant health risks posed by defoliated 1‐ or 2‐year old bare root plants for
EFSA Panel on Plant Health (PLH), Claude Bragard, Paula Baptista, Elisavet Chatzivassiliou, Paolo Gonthier, Josep Anton Jaques Miret, Annemarie Fejer Justesen, Alan MacLeod, Christer Sven Magnusson, Panagiotis Milonas, Juan A. Navas‐Cortes, Stephen Parnell, Roel Potting, Philippe Lucien Reignault, Emilio Stefani, Hans‐Hermann Thulke, Wopke Van der Werf, Antonio Vicent Civera, Lucia Zappalà, Francesco Di Serio, Pedro Gómez, Gregor Urek, Andrea Lucchi, Anna Vittoria Carluccio, Michela Chiumenti, Elena Fanelli, Umberto Bernardo, Cristina Marzachì, Giovanni Bubici, Spyridoula Dimitropoulou, Cristiana Do Vale Correia, Olaf Mosbach‐Schulz, Agata Kaczmarek, Jonathan Yuen   +33 more
wiley   +1 more source

DEVELOPMENT OF DIAGNOSTIC KIT AGAINST THE RECOMBINANT COAT PROTEIN OF PRUNUS NECROTIC RINGSPOT VIRUS.

, 2010
1. Primers useful for detection of Prunus necrotic ringspot virus (PNRSV) in plants, comprising the following sequence: Sequence ID 1: upstream primer AACTGCAGATGGTTTGCCGAATTTGCAA Sequence ID 2: downstream primer GCTCTAGACTAGATCTCAAGCAGGTC 2.
Hallan, Vipin, Raikhy, G, Zaidi, A A, Kulshrestha, S   +3 more
core  

Investigation on biological properties of Prunus Necrotic Ringspot Virus isolates from different stone fruit species

Растениевъдни науки, 2015
The biological properties of five Bulgarian isolates of Prunus necrotic ringspot virus (PNRSV) originated from sweet cherry, sour cherry, peach and plum, identified by ELISA, were studied during the period 2013 – 2014.
Anelia Borisova
doaj  

Commodity risk assessment of Cornus alba and Cornus sanguinea plants from the UK

EFSA Journal, Volume 22, Issue 3, March 2024.
Abstract The European Commission requested the EFSA Panel on Plant Health to prepare and deliver risk assessments for commodities listed in Commission Implementing Regulation (EU) 2018/2019 as ‘high risk plants, plant products and other objects’. Taking into account the available scientific information, including the technical information provided by ...
EFSA Panel on Plant Health (PLH), Claude Bragard, Paula Baptista, Elisavet Chatzivassiliou, Francesco Di Serio, Paolo Gonthier, Josep Anton Jaques Miret, Annemarie Fejer Justesen, Alan MacLeod, Christer Sven Magnusson, Panagiotis Milonas, Juan A. Navas‐Cortes, Stephen Parnell, Philippe Lucien Reignault, Emilio Stefani, Hans‐Hermann Thulke, Wopke Van der Werf, Antonio Vicent Civera, Jonathan Yuen, Lucia Zappalà, Raghavendra Reddy Manda, Olaf Mosbach Schulz, Paraskevi Kariampa, Antigoni Akrivou, Spyridon Antonatos, Despoina Beris, Jane Debode, Christos Kritikos, Maria Kormpi, Charles Manceau, Dimitrios Papachristos, Chrysavgi Reppa, Ciro Gardi, Roel Potting   +33 more
wiley   +1 more source

Effect of infection by viruses on vegetative and reproductive growth of sweet cherry on Damil and Inmil rootstocks

Horticultural Science, 2002
The effect of infection with Prunus necrotic ringspot virus (PNRSV) and Prune dwarf virus (PDV) on vegetative and reproductive growth of sweet cherry trees (Prunus avium L.) was investigated.
D. Andersone, H. Wustenberghs, N.C. Cook, J. Keulemans   +3 more
doaj   +1 more source

Zróżnicowanie genetyczne genu kodującego białko płaszcza izolatów Prunus necrotic ringspot virus

, 2013
We have obtained and described the nucleotide sequences corresponding to ilarvirus Prunus necrotic ringspot virus (PNRSV] coat protein (CP) gene in eleven Polish isolates, from different Prunus and Rosa species and four isolates provided in plant ...
Paduch-Cichal, E., Sala-Rejczak, K.
core  

Comparative Expression Profiling of Nicotiana benthamiana Leaves Systemically Infected with Three Fruit Tree Viruses

Molecular Plant-Microbe Interactions, 2007
Plant viruses cause a wide array of disease symptoms and cytopathic effects. Although some of these changes are virus specific, many appear to be common even among diverse viruses.
Christopher Dardick
doaj   +1 more source

First report of Mercurialis latent virus infecting courgette in France

New Disease Reports, Volume 50, Issue 2, October–December 2024.
Cecile Desbiez, Catherine Wipf‐Scheibel, Eric Verdin, Herve Lecoq   +3 more
wiley   +1 more source

Evaluation of Viral Status and Susceptibility of Sweet Cherry Cultivars to Cherry Leaf Spot Blumeriella jaapii (Rehm)

Растениевъдни науки, 2014
The aim of this study is to assess the viral status and susceptibility to Blumeriella jaapii of ten new to the region of Kyustendil cherry cultivars grafted on Gisela 5.
Aneliya Borisova, Maria Borovinova
doaj