Results 31 to 40 of about 7,362 (203)
Cobra Venom Acetylcholinesterase [PDF]
European Journal of Biochemistry, 1979 Acetylcholinesterase from cobra (Naja naja oxiana) venom has been purified by affinity chromatography to an homogeneous state, as ascertained by sodium dodecylsulfate/polyacrylamide gel electrophoresis and sedimentation analysis. The specific activity of the preparation was 5000 IU/mg with acetylcholine as substrate.Unlike acetylcholinesterases from ...
R, Raba +3 more
openaire +2 more sources
Additional file 1 of miRNAs derived from cobra venom exosomes contribute to the cobra envenomation
, 2023 Additional file1 of miRNAs derived from cobra venom exosomes contribute to the cobra envenomation: Figure S1. A The Nucleotide Blast results of CV-exo-miR-2904 sequence (GCCTCGGTGGGCCTCGGATAGCCG) on NCBI.
Ye Zhao (39959) +13 more
core +1 more source
Unexpected lack of specialisation in the flow properties of spitting cobra venom [PDF]
, 2021 Venom spitting is a defence mechanism based on airborne venom delivery used by a number of different African and Asian elapid snake species (‘spitting cobras’; Naja spp. and Hemachatus spp.).
Holland, C. +25 more
core +1 more source
Molecular dissection of cobra venom highlights heparinoids as an antidote for spitting cobra envenoming [PDF]
Snakebites affect about 1.8 million people annually. The current standard of care involves antibody-based antivenoms, which can be difficult to access and are generally not effective against local tissue injury, the primary cause of morbidity.
Neely, G Gregory +18 more
core +3 more sources
Local Cytotoxic Effects in Cobra Envenoming: A Pilot Study
Toxins, 2022 The cobra (genus Naja (N.)) is one of the most common venomous snakes. Due to its frequency and deadly complications of muscle paralysis, local necrosis, and chronic musculoskeletal disability, it should not be ignored.
Jing-Hua Lin +3 more
doaj +1 more source
Toxins, 2020 Latest advancement of omics technologies allows in-depth characterization of venom compositions. In the present work we present a proteomic study of two snake venoms of the genus Naja i.e., Naja naja (black cobra) and Naja oxiana (brown cobra) of ...
Aisha Manuwar +8 more
doaj +1 more source
, 1995 Venom, venom IgG and IgM antibody and total serum IgG levels following king cobra bites in two reptile handlers were measured by enzyme immunoassay. The patient in case 1 received antivenom while the patient in case 2 did not.
Warrell, DA
core +2 more sources
Proteomic characterization of Naja mandalayensis venom
Journal of Venomous Animals and Toxins including Tropical Diseases, 2021 Background Naja mandalayensis is a spitting cobra from Myanmar. To the best of our knowledge, no studies on this venom composition have been conducted so far.
Emídio Beraldo Neto +3 more
doaj +1 more source
Pharmacological aspects of Vipera xantina palestinae venom
, 2011 In Israel, Vipera xantina palestinae (V.x.p.) is the most common venomous snake, accounting for several hundred cases of envenomation in humans and domestic animals every year, with a mortality rate of 0.5 to 2%.
Katzhendler, Jeoshua +14 more
core +1 more source