Results 121 to 130 of about 1,480,527 (305)

SELEÇÃO DE MARCADORES ISSR PARA Schizolobium parahyba var. amazonicum (Huber ex. Ducke) Barneby

Revista UniVap, 2017
O objetivo deste trabalho foi selecionar primers ISSR para serem utilizados em futuras análises de diversidade genética em população de S. amazonicum, conhecido popularmente como Paricá.
Adelson Lemes da Silva Júnior, Lucimara Cruz de Souza, Aléxia Gonçalves Pereira, Kelmer Mozer Moro, Mariana Cruz de Souza, Alessandra Abreu Rodrigues, Izabela Ferreira Ribeiro, Fábio Demolinari de Miranda, Marcos Vinicus Winckler Caldeira   +8 more
doaj   +1 more source

Crucial parameters for precise copy number variation detection in formalin‐fixed paraffin‐embedded solid cancer samples

Molecular Oncology, EarlyView.
This study shows that copy number variations (CNVs) can be reliably detected in formalin‐fixed paraffin‐embedded (FFPE) solid cancer samples using ultra‐low‐pass whole‐genome sequencing, provided that key (pre)‐analytical parameters are optimized.
Hanne Goris, Vasiliki Siozopoulou, Léon C van Kempen, Anne Sieben, Ella Roelant, Stig Hellemans, Elyne Backx, Laure Sorber, Koen De Winne, Senada Koljenović, Karen Zwaenepoel   +10 more
wiley   +1 more source

Comparison of Two Multiplex PCR Systems for Meat Species Authentication

Journal of Food Quality and Hazards Control, 2019
Background: Meat species adulteration has become a problem of concern. This study aimed to compare two previously published multiplex Polymerase Chain Reaction (PCR) methods for meat species authentication.
D. Al-taghlubee, A. Misaghi, P. Shayan, A. Akhondzadeh Basti, H. Gandomi, D. Shayan   +5 more
doaj  

DNA - Ball Python DNA Amplification with TFEC primers v1

, 2022
PCR amplification with Tfec set Exon 5 to genotype Piedball morph in Ball python (Python regius) LEFT PRIMER AACTCAGAGCACTCCATGACC RIGHT PRIMER CAGGTGTGCCCCTTTCATAA
openaire   +1 more source

Dammarenediol II enhances etoposide‐induced apoptosis by targeting O‐GlcNAc transferase and Akt/GSK3β/mTOR signaling in liver cancer

Molecular Oncology, EarlyView.
Etoposide induces DNA damage, activating p53‐dependent apoptosis via caspase‐3/7, which cleaves PARP1. Dammarenediol II enhances this apoptotic pathway by suppressing O‐GlcNAc transferase activity, further decreasing O‐GlcNAcylation. The reduction in O‐GlcNAc levels boosts p53‐driven apoptosis and influences the Akt/GSK3β/mTOR signaling pathway ...
Jaehoon Lee, Byung‐Cheol Han, Gi‐Bang Koo, Jihye Park, Mijin Kwon, Young Bin Park, Jae‐Mun Choi, Seung‐Ho Lee, Sangho Roh   +8 more
wiley   +1 more source

TRAIL‐PEG‐Apt‐PLGA nanosystem as an aptamer‐targeted drug delivery system potential for triple‐negative breast cancer therapy using in vivo mouse model

Molecular Oncology, EarlyView.
Aptamers are used both therapeutically and as targeting agents in cancer treatment. We developed an aptamer‐targeted PLGA–TRAIL nanosystem that exhibited superior therapeutic efficacy in NOD/SCID breast cancer models. This nanosystem represents a novel biotechnological drug candidate for suppressing resistance development in breast cancer.
Gulen Melike Demirbolat, Aslihan Kucuk, Omer Erdogan, Samed Ozer, Bensu Kozan, Tugba Cuceli, Erkan Gumus, Evrim Cevik, Ozge Cevik   +8 more
wiley   +1 more source

PEMILIHAN PRIMER RAPD (RANDOM AMPLIFIED POLYMORPHIC DNA) PADA PCR (POLYMERASE CHAIN REACTION) TANAMAN KAMBOJA (Plumeria sp.)

Simbiosis: Journal of Biological Sciences, 2016
There are many variation of Plumeria sp. that grown in Bali. The genetic identity of Plumeria sp. need to be analysed using molecular study for plant breeding purpose.
Vanesa Martida, Made Pharmawati
doaj  

Culicidae-centric metabarcoding through targeted use of D2 ribosomal DNA primers. [PDF]

PeerJ, 2020
Pedro PM, Amorim J, Rojas MVR, Sá IL, Galardo AKR, Santos Neto NF, Pires de Carvalho D, Nabas Ribeiro KA, Razzolini MTP, Sallum MAM.   +9 more
europepmc   +1 more source

Correlation of the differential expression of PIK3R1 and its spliced variant, p55α, in pan‐cancer

Molecular Oncology, EarlyView.
PIK3R1 undergoes alternative splicing to generate the isoforms, p85α and p55α. By combining large patient datasets with laboratory experiments, we show that PIK3R1 spliced variants shape cancer behavior. While tumors lose the protective p85α isoform, p55α is overexpressed, changes linked to poorer survival and more pronounced in African American ...
Ishita Gupta, Yang Song, Madeleine Ndahayo, Anirudh Saxena, Theresa Guo, Dylan Z. Kelley, Jessica Gore, Andrew Hennigan, Alexa Anderson, John C. Papadimitriou, Daria A. Gaykalova   +10 more
wiley   +1 more source

Usefulness of microsatellite loci for differentiating between Dibothriocephalus dendriticus and Dibothriocephalus ditremus (Cestoda: Diphyllobothriidea)

Parasite
Differentiating between two diphyllobothriid tapeworms Dibothriocephalus dendriticus and Dibothriocephalus ditremus is complicated due to their morphological plasticity, intraspecific variability and a wide range of common hosts.
Králová-Hromadová Ivica, Dinisová Lucia, Radačovská Alžbeta, Karlsbakk Egil, Skírnisson Karl, Čisovská Bazsalovicsová Eva   +5 more
doaj   +1 more source