Results 31 to 40 of about 1,084,447 (193)
Physical correction filter for improving the optical quality of an image [PDF]
, 1975 A family of physical correction filters is described. Each filter is designed to correct image content of a photographed scene of limited resolution and includes a first filter element with a pinhole through which light passes to a differential amplifier.
Lee, S. Y.
core +1 more source
Changes in cytoskeletal gene expression linked to MPTP-treatment in Mice
Neurobiology of Disease, 2005 Parkinson's disease is a neurodegenerative disorder characterized by the progressive loss of dopaminergic neurons in the substantia nigra and a marked reduction of dopamine (DA) levels in the striatum.
Mar Cuadrado-Tejedor +3 more
doaj +1 more source
Genetics and Molecular Biology, 2009 An investigation of differences in gene expression in the longissimus muscle of Meishan and Large White pigs was undertaken, using the mRNA display technique.
Liu Yonggang +3 more
doaj +1 more source
Chaos and plasticity in superconductor vortices: a low-dimensional dynamics
, 2008 We present new results of numerical simulations for driven vortex lattices in presence of random disorder at zero temperature. We show that the plastic dynamics of vortices display dissipative chaos.
E. Olive +4 more
core +3 more sources
Multi Stage based Time Series Analysis of User Activity on Touch Sensitive Surfaces in Highly Noise Susceptible Environments [PDF]
, 2015 This article proposes a multistage framework for time series analysis of user activity on touch sensitive surfaces in noisy environments. Here multiple methods are put together in multi stage framework; including moving average, moving median, linear ...
Jaganade, Sachin, Vanga, Sandeep
core +1 more source
Electrophoretic Signal Comparison Applied to mRNA Differential Display Analysis
BioTechniques, 2003 Gene expression analysis by electrophoretic methods is currently limited by the labor-intensive visual evaluation of the electrophoretic signal profiles.
T. Aittokallio +4 more
doaj +1 more source
Teaching Partial Differential Equations with CAS [PDF]
, 2018 Partial Differential Equations (PDE) are one of the topics where Engineering students find more difficulties when facing Math subjects. A basic course in Partial Differential Equations (PDE) in Engineering, usually deals at least, with the following ...
Aguilera-Venegas, Gabriel +5 more
core
Shot noise of inelastic tunneling through quantum dot systems [PDF]
, 2004 We present a theoretical analysis of the effect of inelastic electron scattering on current and its fluctuations in a mesoscopic quantum dot (QD) connected to two leads, based on a recently developed nonperturbative technique involving the approximate ...
Bing Dong +5 more
core +1 more source
Automated Differential Display Using a Fluorescently Labeled Universal Primer
BioTechniques, 1997 We have modified the automated differential display reverse transcription polymerase chain reaction technique (DDRTPCR) such that a single fluorescently labeled universal primer (d[F]CTCACGGATCCGTCGATTTT) is used in all PCRs together with a selection of ...
N.R. Smith +6 more
doaj +1 more source
Deformations and Extensions of Modified λ-Differential 3-Lie Algebras
Mathematics, 2023 In this paper, we propose the representation and cohomology of modified λ-differential 3-Lie algebras. As their applications, the linear deformations, abelian extensions and T∗-extensions of modified λ-differential 3-Lie algebras are also studied.
Wen Teng, Hui Zhang
doaj +1 more source