Results 1 to 10 of about 10,163 (185)

Engineering strategies and challenges of endolysin as an antibacterial agent against Gram‐negative bacteria

Microbial Biotechnology
Bacteriophage endolysin is a novel antibacterial agent that has attracted much attention in the prevention and control of drug‐resistant bacteria due to its unique mechanism of hydrolysing peptidoglycans.
Tianyu Zheng, Can Zhang
doaj   +2 more sources

Development of Chimera AMP–Endolysin with Wider Spectra Against Gram-Negative Bacteria Using High-Throughput Assay

Viruses
Bacteriophage-derived endolysins are being developed as an alternative to antimicrobials. The development of endolysins against Gram-negative bacteria requires the discovery of effective endolysins against the target species and the capability to ...
Masato Kogawa, Takuya Yoda, Ayumi Matsuhashi, Ai Matsushita, Yoshiki Otsuka, Shohei Shibagaki, Masahito Hosokawa, Soichiro Tsuda   +7 more
doaj   +2 more sources

The C-terminal domain of T9SS component protein SprA assists Flavobacterium psychrophilum bacteriophage endolysin Ely174 to lyse Gram-negative bacteria [PDF]

Applied and Environmental Microbiology
Flavobacterium psychrophilum is the pathogen of bacterial cold-water disease, causing enormous economic losses in aquaculture. Antibiotic therapy to control F. psychrophilum risks the development of drug-resistant strains.
Shuaishuai Xie, Yaoyajie Lu, Xueer Li, Yifan Xu, Xianglin Cao, Jianjun Chen   +5 more
doaj   +2 more sources

Antibacterial activity of vB_AbaM_PhT2 phage hydrophobic amino acid fusion endolysin, combined with colistin against Acinetobacter baumannii

Scientific Reports, 2023
Phage lytic enzymes are promising antimicrobial agents. In this study, an endolysin derived from vB_AbaM_PhT2 (vPhT2), was identified. This endolysin represented the conserved lysozyme domain.
Sutthirat Sitthisak, Suphattra Manrueang, Supat Khongfak, Udomluk Leungtongkam, Rapee Thummeepak, Aunchalee Thanwisai, Nathan Burton, Gurneet K. Dhanoa, Panagiotis Tsapras, Antonia P. Sagona   +9 more
doaj   +2 more sources

Insight into the Lytic Functions of the Lactococcal Prophage TP712 [PDF]

Viruses, 2019
The lytic cassette of Lactococcus lactis prophage TP712 contains a putative membrane protein of unknown function (Orf54), a holin (Orf55), and a modular endolysin with a N-terminal glycoside hydrolase (GH_25) catalytic domain and two C-terminal LysM ...
Susana Escobedo, Ana Belén Campelo, Udo Wegmann, Pilar García, Ana Rodríguez, and Beatriz Martínez   +5 more
doaj   +3 more sources

Phage and Endolysin Therapy Against Antibiotics Resistant Bacteria: From Bench to Bedside. [PDF]

MedComm (2020)
The rapid global spread of antibiotic‐resistant bacteria presents a growing public health crisis, threatening the efficacy of existing antimicrobial treatments.
Taati Moghadam M, Mohebi S, Sheikhi R, Hasannejad-Bibalan M, Shahbazi S, Nemati S.   +5 more
europepmc   +2 more sources

Identification of a novel bacteriophage attachment site into ffs, the 4.5S non-coding RNA component of the signal recognition particle [PDF]

Scientific Reports
Bioinformatic analysis of Enterococcus faecalis temperate phage ϕEf11 identified prospective attP and attB core attachment (att) sites consisting of identical 27 nt sequences (ACTAAGCAAGTGCCGCCATGTGTCTGA). The presumptive attPcore site was located 74 nts
Roy H. Stevens, Hongming Zhang, Derrick E. Fouts   +2 more
doaj   +2 more sources

SP-CHAP, an endolysin with enhanced activity against biofilm pneumococci and nasopharyngeal colonization

mBio
Streptococcus pneumoniae (Spn), a Gram-positive bacterium, is responsible for causing a wide variety of invasive infections. The emergence of multi-drug antibiotic resistance has prompted the search for antimicrobial alternatives.
Adit B. Alreja, Amanda E. Appel, Jinyi C. Zhu, Sean P. Riley, Norberto Gonzalez-Juarbe, Daniel C. Nelson   +5 more
doaj   +2 more sources

Endolysin significantly improves symptoms with atopic dermatitis: bridging the gap from research to clinical practice [PDF]

Frontiers in Immunology
BackgroundAtopic Dermatitis (AD), a chronic inflammatory skin disease characterized by pruritus, dryness, redness, edema, scratching, and lichenification, ranks as the leading cause of non-fatal skin disease burden globally.
Ling Kui, Jinqun Huang, Jinqun Huang, Guoyun Wang, Jiamin Zhao, Jiamin Zhao, Shuangshuang Wang, Xiaoxing Qin, Xiaoxing Qin, Leifeng Liu, Jianfei Hu, Lianjia Chen, Xingchun Wang, Qing Li, Yuqian Zhao, Yuqian Zhao, Yuanyue Tang, Yuanyue Tang, Kexu Xiong, Shuxia Zhan, Honghua Ding, JunLing Wang, Hua Cai, Qing Zhang, Xiaoyan Zi, Qiong Deng, Lian Gao, Xuan Wang, Chaowei Zou, Huilin Yang, Yue Xiao, Bin Yang, Bingfeng Leng, Bingfeng Leng, Li Zhang, Gang Hu   +35 more
doaj   +2 more sources

Reduced binding of the endolysin LysTP712 to Lactococcus lactis ΔftsH contributes to phage resistance [PDF]

Frontiers in Microbiology, 2016
Absence of the membrane protease FtsH in Lactococcus lactis hinders release of the bacteriophage TP712. In this work we have analysed the mechanism responsible for the non-lytic phenotype of L. lactis ΔftsH after phage infection.
CLARA eROCES, Ana Belén Campelo, Susana eEscobedo, Udo eWegmann, Pilar eGarcía, Ana eRodriguez, Beatriz eMartínez   +6 more
doaj   +4 more sources