Results 11 to 20 of about 8,598 (217)

Lysis-deficient phages as novel therapeutic agents for controlling bacterial infection [PDF]

BMC Microbiology, 2011
Background Interest in phage therapy has grown over the past decade due to the rapid emergence of antibiotic resistance in bacterial pathogens. However, the use of bacteriophages for therapeutic purposes has raised concerns over the potential for immune ...
Kempashanaiah Nanjundappa, Hariharan Sukumar, Rajagopalan Sanjeev, Sundarrajan Sudarson, Paul Vivek, Padmanabhan Sriram, Sriram Bharathi, Ramachandran Janakiraman   +7 more
doaj   +4 more sources

Antibacterial Activity of Stenotrophomonas maltophilia Endolysin P28 against both Gram-positive and Gram-negative Bacteria

Frontiers in Microbiology, 2015
Maltocin P28 is a phage-tail like bacteriocin produced by Stenotrophomonas maltophilia P28. The ORF8 of maltocin P28 gene cluster is predicted to encode an endolysin and we name it endolysin P28.
Yu-Ping Huang
exaly   +3 more sources

The C-terminal domain of T9SS component protein SprA assists Flavobacterium psychrophilum bacteriophage endolysin Ely174 to lyse Gram-negative bacteria [PDF]

Applied and Environmental Microbiology
Flavobacterium psychrophilum is the pathogen of bacterial cold-water disease, causing enormous economic losses in aquaculture. Antibiotic therapy to control F. psychrophilum risks the development of drug-resistant strains.
Shuaishuai Xie, Yaoyajie Lu, Xueer Li, Yifan Xu, Xianglin Cao, Jianjun Chen   +5 more
doaj   +2 more sources

Computational insights into the natural phage endolysin linker landscape [PDF]

BioData Mining
Phage endolysins are increasingly investigated as novel protein-based antibiotics, offering solutions to the antibiotic resistance crisis. Endolysins targeting Gram-positive bacteria come in a variety of modular architectures, combining domains that bind
Emma Cremelie, Alexandre Boulay, Roberto Vázquez, Yves Briers   +3 more
doaj   +2 more sources

Phage-Encoded Endolysins [PDF]

Antibiotics, 2021
Due to the global emergence of antibiotic resistance, there has been an increase in research surrounding endolysins as an alternative therapeutic. Endolysins are phage-encoded enzymes, utilized by mature phage virions to hydrolyze the cell wall from within. There is significant evidence that proves the ability of endolysins to degrade the peptidoglycan
Fatma Abdelrahman, Maheswaran Easwaran, Oluwasegun I. Daramola, Samar Ragab, Stephanie Lynch, Tolulope J. Oduselu, Fazal Mehmood Khan, Akomolafe Ayobami, Fazal Adnan, Eduard Torrents, Swapnil Sanmukh, Ayman El-Shibiny   +11 more
openaire   +5 more sources

Identification of a novel bacteriophage attachment site into ffs, the 4.5S non-coding RNA component of the signal recognition particle [PDF]

Scientific Reports
Bioinformatic analysis of Enterococcus faecalis temperate phage ϕEf11 identified prospective attP and attB core attachment (att) sites consisting of identical 27 nt sequences (ACTAAGCAAGTGCCGCCATGTGTCTGA). The presumptive attPcore site was located 74 nts
Roy H. Stevens, Hongming Zhang, Derrick E. Fouts   +2 more
doaj   +2 more sources

Investigation of Recombinantly Produced Endolysins Reveals a Modular Enzyme Shared by Several Enterobacteria Phages to Exhibit Broad-Range Lytic Activity Against Different Orders of Gammaproteobacteria. [PDF]

Microbiologyopen
The recombinant endolysin El1 derived from Enterobacteria bacteriophages showed potent bactericidal activity against Gram‐negative bacteria when applied exogenously, even in the absence of membrane‐permeabilizing agents, such as ethylenediaminetetraacetic acid (EDTA).
Kazaka T, Zrelovs N, Akopjana I, Bogans J, Jansons J, Dislers A, Kazaks A.   +6 more
europepmc   +2 more sources

Potential Role of the Host-Derived Cell-Wall Binding Domain of Endolysin CD16/50L as a Molecular Anchor in Preservation of Uninfected Clostridioides difficile for New Rounds of Phage Infection

Microbiology Spectrum, 2022
Endolysin is a phage-encoded cell-wall hydrolase which degrades the peptidoglycan layer of the bacterial cell wall. The enzyme is often expressed at the late stage of the phage lytic cycle and is required for progeny escape.
Wichuda Phothichaisri, Surang Chankhamhaengdecha, Tavan Janvilisri, Jirayu Nuadthaisong, Tanaporn Phetruen, Robert P. Fagan, Sittinan Chanarat   +6 more
doaj   +1 more source

Combination Treatment for Inhibition of the Growth of Staphylococcus aureus with Recombinant SAP8 Endolysin and Nisin

Antibiotics, 2022
Staphylococcus aureus, a pathogenic species of genus Staphylococcus involved in foodborne illness always remain among the top priorities of the world major concerns.
Seon-Gyu Kim, Shehzad Abid Khan, Young-Duck Lee, Jong-Hyun Park, Gi-Seong Moon   +4 more
doaj   +1 more source

Immunogenicity of Endolysin PlyC

Antibiotics, 2022
Endolysins are bacteriolytic enzymes derived from bacteriophages. They represent an alternative to antibiotics, since they are not susceptible to conventional antimicrobial resistance mechanisms. Since non-human proteins are efficient inducers of specific immune responses, including the IgG response or the development of an allergic response mediated ...
Marek Adam Harhala, Katarzyna Gembara, Daniel C. Nelson, Paulina Miernikiewicz, Krystyna Dąbrowska   +4 more
openaire   +3 more sources