Results 81 to 90 of about 6,966 (163)
DUF3380 domain from a Salmonella phage endolysin shows potent N-acetylmuramidase activity [PDF]
Bacteriophage-encoded endolysins are highly diverse enzymes that cleave the bacterial peptidoglycan layer. Current research focuses on their potential applications in medicine, in food conservation, and as biotechnological tools.
Rodríguez-Rubio, Lorena +12 more
core +1 more source
Objectives: Isolation of endolysin from Staphylococcus aureus bacteriophages, and administering them systemic In vivo lab animal and measure the therapeutic efficacy as well as evaluation of their biosafety. Method: This study was performed from March
Mohammed R. Ali +2 more
doaj
The global rise of multidrug-resistant bacteria poses a critical threat to public health, and bacteriophage-derived endolysins have emerged as promising alternatives to conventional antibiotics.
Eunsuk Kim +6 more
core +1 more source
: Objective: Bacteriophage-encoded endolysins have emerged as novel antibacterial strategies against antibiotic-resistant bacteria. We identified a bacteriophage-derived conserved sequence encoding an endolysin specific to Staphylococcus aureus.
Carla Rivero +14 more
doaj +1 more source
Antibiotic-resistant bacteria are rapidly emerging, and the increasing prevalence of multidrug-resistant (MDR) Acinetobacter baumannii poses a severe threat to humans and healthcare organizations, due to the lack of innovative antibacterial drugs ...
Fazal Mehmood Khan +6 more
doaj +1 more source
Endolysins are bacteriophage-encoded hydrolases that show high antibacterial activity and a narrow substrate spectrum. We hypothesize that an mRNA-based approach to endolysin therapy can overcome some challenges of conventional endolysin therapy, namely ...
Moritz K. Jansson +7 more
doaj +1 more source
Effect of endolysin XZ.700 on monocyte differentiation into osteoclasts and foreign body giant cells
Periprosthetic joint infections due to biofilm formation are a major concern in orthopaedic and dental implant surgery. Current treatment options use antibiotics, but antibiotic-resistant bacteria in the biofilm cause treatment failure.
Zandieh-Doulabi, Behrouz; id_orcid +5 more
core +1 more source
International PatentThe present invention relates to a polypeptide with endolysin activity and amino acid sequences according to SEQ ID No. 1 and fragments or derivatives thereof. Moreover, the present invention relates to nucleic acid molecules encoding
Oliveira, Hugo Alexandre Mendes +1 more
core
Streptococcus pneumoniae (Spn), a Gram-positive bacterium, is responsible for causing a wide variety of invasive infections. The emergence of multi-drug antibiotic resistance has prompted the search for antimicrobial alternatives.
Adit B. Alreja +5 more
doaj +1 more source
Bioinformatic analysis of Enterococcus faecalis temperate phage ϕEf11 identified prospective attP and attB core attachment (att) sites consisting of identical 27 nt sequences (ACTAAGCAAGTGCCGCCATGTGTCTGA). The presumptive attPcore site was located 74 nts
Roy H. Stevens +2 more
doaj +1 more source

