Results 81 to 90 of about 6,966 (163)

DUF3380 domain from a Salmonella phage endolysin shows potent N-acetylmuramidase activity [PDF]

, 2016
Bacteriophage-encoded endolysins are highly diverse enzymes that cleave the bacterial peptidoglycan layer. Current research focuses on their potential applications in medicine, in food conservation, and as biotechnological tools.
Rodríguez-Rubio, Lorena, Rodríguez-Rubio, L., Thorpe, Simon, Mesnage, Stéphane, Lorena Rodriguez-Rubio, Lorena, Thorpe, S., Briers, Yves, Lavigne, Rob, Gerstmans, H., Lavigne, R., Briers, Y., Gerstmans, Hans, Mesnage, S.   +12 more
core   +1 more source

Extraction, Purification and Therapeutic Use of Bacteriophage Endolysin against Multi-Drug Resistant Staphylococcus aureus: in-vivo and in-vitro study

Journal of Contemporary Medical Sciences, 2018
Objectives: Isolation of endolysin from Staphylococcus aureus bacteriophages, and administering them systemic In vivo lab animal and measure the therapeutic efficacy as well as evaluation of their biosafety. Method: This study was performed from March
Mohammed R. Ali, Ahmed S. Abdulamir, Shurooq R. Kadhim   +2 more
doaj  

Transcriptomic insights into the effects of sublethal exposure to endolysin LNT113 on Escherichia coli

The global rise of multidrug-resistant bacteria poses a critical threat to public health, and bacteriophage-derived endolysins have emerged as promising alternatives to conventional antibiotics.
Eunsuk Kim, Seowon Jang, Hyunjin Yoon, Nanjoo Park, Sunghoon Kim, Heymin Song, Jeongik Cho   +6 more
core   +1 more source

Antibacterial activity of recombinant endolysin LysNOVA-I against growing/non-growing and planktonic/biofilm cultures of Staphylococcus aureus strains

Journal of Global Antimicrobial Resistance
: Objective: Bacteriophage-encoded endolysins have emerged as novel antibacterial strategies against antibiotic-resistant bacteria. We identified a bacteriophage-derived conserved sequence encoding an endolysin specific to Staphylococcus aureus.
Carla Rivero, Melina M.B. Martínez, Nicole G. Picinin, Eduardo G. Martins, Claudio Paolazzi, Alejandra Capozzo, Denise da Silva Oliveira, Johana Becerra, Benedito M. dos Santos, Lucio H.G. de Freitas-Junior, Andrea Balan, Nilton Lincopan, Rita de Cassia Café Ferreira, Luis Carlos de Souza Ferreira, Leticia Verónica Bentancor   +14 more
doaj   +1 more source

Endolysins: a new antimicrobial agent against antimicrobial resistance. Strategies and opportunities in overcoming the challenges of endolysins against Gram-negative bacteria

Frontiers in Pharmacology
Antibiotic-resistant bacteria are rapidly emerging, and the increasing prevalence of multidrug-resistant (MDR) Acinetobacter baumannii poses a severe threat to humans and healthcare organizations, due to the lack of innovative antibacterial drugs ...
Fazal Mehmood Khan, Fazal Mehmood Khan, Fazal Rasheed, Yunlan Yang, Bin Liu, Rui Zhang, Rui Zhang   +6 more
doaj   +1 more source

Synthetic mRNA delivered to human cells leads to expression of Cpl-1 bacteriophage-endolysin with activity against Streptococcus pneumoniae

Molecular Therapy: Nucleic Acids
Endolysins are bacteriophage-encoded hydrolases that show high antibacterial activity and a narrow substrate spectrum. We hypothesize that an mRNA-based approach to endolysin therapy can overcome some challenges of conventional endolysin therapy, namely ...
Moritz K. Jansson, Dat Tien Nguyen, Stefan Mikkat, Carolin Warnke, Marc Benjamin Janssen, Philipp Warnke, Bernd Kreikemeyer, Nadja Patenge   +7 more
doaj   +1 more source

Effect of endolysin XZ.700 on monocyte differentiation into osteoclasts and foreign body giant cells

Periprosthetic joint infections due to biofilm formation are a major concern in orthopaedic and dental implant surgery. Current treatment options use antibiotics, but antibiotic-resistant bacteria in the biofilm cause treatment failure.
Zandieh-Doulabi, Behrouz; id_orcid, Klein-Nulend, Jenneke, van Gils, Sterre R., Nolte, Peter A., Schoenmaker, Ton; id_orcid, Jin, Jianfeng   +5 more
core   +1 more source

Novel endolysin

, 2019
International PatentThe present invention relates to a polypeptide with endolysin activity and amino acid sequences according to SEQ ID No. 1 and fragments or derivatives thereof. Moreover, the present invention relates to nucleic acid molecules encoding
Oliveira, Hugo Alexandre Mendes, Azeredo, Joana   +1 more
core  

SP-CHAP, an endolysin with enhanced activity against biofilm pneumococci and nasopharyngeal colonization

mBio
Streptococcus pneumoniae (Spn), a Gram-positive bacterium, is responsible for causing a wide variety of invasive infections. The emergence of multi-drug antibiotic resistance has prompted the search for antimicrobial alternatives.
Adit B. Alreja, Amanda E. Appel, Jinyi C. Zhu, Sean P. Riley, Norberto Gonzalez-Juarbe, Daniel C. Nelson   +5 more
doaj   +1 more source

Identification of a novel bacteriophage attachment site into ffs, the 4.5S non-coding RNA component of the signal recognition particle

Scientific Reports
Bioinformatic analysis of Enterococcus faecalis temperate phage ϕEf11 identified prospective attP and attB core attachment (att) sites consisting of identical 27 nt sequences (ACTAAGCAAGTGCCGCCATGTGTCTGA). The presumptive attPcore site was located 74 nts
Roy H. Stevens, Hongming Zhang, Derrick E. Fouts   +2 more
doaj   +1 more source