Results 71 to 80 of about 5,520 (176)

Effective Removal of Staphylococcal Biofilms by the Endolysin LysH5

PLoS ONE, 2014
Staphylococcal biofilms are a major concern in both clinical and food settings because they are an important source of contamination. The efficacy of established cleaning procedures is often hindered due to the ability of some antimicrobial compounds to induce biofilm formation, and to the presence of persister cells, a small bacterial subpopulation ...
Diana Gutiérrez, Patricia Ruas-Madiedo, Beatriz Martínez, Ana Rodríguez, Pilar García   +4 more
openaire   +5 more sources

Bacteriophage Endolysins as a Novel Class of Antibacterial Agents

Experimental Biology and Medicine, 2006
Endolysins are double-stranded DNA bacteriophage-encoded peptidoglycan hydrolases produced in phage-infected bacterial cells toward the end of the lytic cycle. They reach the peptidoglycan through membrane lesions formed by holins and cleave it, thus, inducing lysis of the bacterial cell and enabling progeny virions to be released.
Jan Jakub Borysowski, Weber-Dabrowska, Beata, Andrzej Górski   +2 more
openaire   +2 more sources

Extraction, Purification and Therapeutic Use of Bacteriophage Endolysin against Multi-Drug Resistant Staphylococcus aureus: in-vivo and in-vitro study

Journal of Contemporary Medical Sciences, 2018
Objectives: Isolation of endolysin from Staphylococcus aureus bacteriophages, and administering them systemic In vivo lab animal and measure the therapeutic efficacy as well as evaluation of their biosafety. Method: This study was performed from March
Mohammed R. Ali, Ahmed S. Abdulamir, Shurooq R. Kadhim   +2 more
doaj  

Antibacterial activity of recombinant endolysin LysNOVA-I against growing/non-growing and planktonic/biofilm cultures of Staphylococcus aureus strains

Journal of Global Antimicrobial Resistance
: Objective: Bacteriophage-encoded endolysins have emerged as novel antibacterial strategies against antibiotic-resistant bacteria. We identified a bacteriophage-derived conserved sequence encoding an endolysin specific to Staphylococcus aureus.
Carla Rivero, Melina M.B. Martínez, Nicole G. Picinin, Eduardo G. Martins, Claudio Paolazzi, Alejandra Capozzo, Denise da Silva Oliveira, Johana Becerra, Benedito M. dos Santos, Lucio H.G. de Freitas-Junior, Andrea Balan, Nilton Lincopan, Rita de Cassia Café Ferreira, Luis Carlos de Souza Ferreira, Leticia Verónica Bentancor   +14 more
doaj   +1 more source

Endolysins: a new antimicrobial agent against antimicrobial resistance. Strategies and opportunities in overcoming the challenges of endolysins against Gram-negative bacteria

Frontiers in Pharmacology
Antibiotic-resistant bacteria are rapidly emerging, and the increasing prevalence of multidrug-resistant (MDR) Acinetobacter baumannii poses a severe threat to humans and healthcare organizations, due to the lack of innovative antibacterial drugs ...
Fazal Mehmood Khan, Fazal Mehmood Khan, Fazal Rasheed, Yunlan Yang, Bin Liu, Rui Zhang, Rui Zhang   +6 more
doaj   +1 more source

Synthetic mRNA delivered to human cells leads to expression of Cpl-1 bacteriophage-endolysin with activity against Streptococcus pneumoniae

Molecular Therapy: Nucleic Acids
Endolysins are bacteriophage-encoded hydrolases that show high antibacterial activity and a narrow substrate spectrum. We hypothesize that an mRNA-based approach to endolysin therapy can overcome some challenges of conventional endolysin therapy, namely ...
Moritz K. Jansson, Dat Tien Nguyen, Stefan Mikkat, Carolin Warnke, Marc Benjamin Janssen, Philipp Warnke, Bernd Kreikemeyer, Nadja Patenge   +7 more
doaj   +1 more source

SP-CHAP, an endolysin with enhanced activity against biofilm pneumococci and nasopharyngeal colonization

mBio
Streptococcus pneumoniae (Spn), a Gram-positive bacterium, is responsible for causing a wide variety of invasive infections. The emergence of multi-drug antibiotic resistance has prompted the search for antimicrobial alternatives.
Adit B. Alreja, Amanda E. Appel, Jinyi C. Zhu, Sean P. Riley, Norberto Gonzalez-Juarbe, Daniel C. Nelson   +5 more
doaj   +1 more source

Identification of a novel bacteriophage attachment site into ffs, the 4.5S non-coding RNA component of the signal recognition particle

Scientific Reports
Bioinformatic analysis of Enterococcus faecalis temperate phage ϕEf11 identified prospective attP and attB core attachment (att) sites consisting of identical 27 nt sequences (ACTAAGCAAGTGCCGCCATGTGTCTGA). The presumptive attPcore site was located 74 nts
Roy H. Stevens, Hongming Zhang, Derrick E. Fouts   +2 more
doaj   +1 more source

The short cytoplasmic region of phage T4 holin is essential for the transition from impermeable membrane protein complexes to permeable pores

Frontiers in Microbiology
Virulent as well as temperate phages usually require lysis of bacteria to release their progeny into the surrounding. Double-stranded DNA phages achieve lysis by phage-encoded endolysins that degrade the bacterial cell wall.
Jan Michel Frederik Schwarzkopf, Ruth Paola Viveros, Ali Nazmi Burdur, Denise Mehner-Breitfeld, Natalia Tschowri, Thomas Brüser   +5 more
doaj   +1 more source

Polycationic nanopeptide-fused endolysins for the control of Mannheimia haemolytica. [PDF]

Appl Microbiol Biotechnol
Moqaddes S, Du H, Lin J, Hyun JE, Gohar M, Savchenko A, Stanford K, Ralston B, McAllister TA, Niu YD.   +9 more
europepmc   +1 more source