Results 101 to 110 of about 1,266 (160)

dsRNA template synthesis primers.

, 2015
Each primer set consists of an innexin specific region for amplification of the target gene from plasmid, and the T7 promoter sequence (TAATACGACTCACTATAGGGAGA).
Travis L. Calkins (790732), Peter M. Piermarini (416223)   +1 more
core   +1 more source

Toolkits for detailed and high-throughput interrogation of synapses in C. elegans

eLife
Visualizing synaptic connectivity has traditionally relied on time-consuming electron microscopy-based imaging approaches. To scale the analysis of synaptic connectivity, fluorescent protein-based techniques have been established, ranging from the ...
Maryam Majeed, Haejun Han, Keren Zhang, Wen Xi Cao, Chien-Po Liao, Oliver Hobert, Hang Lu   +6 more
doaj   +1 more source

Identification of testis development-related genes by combining Iso-Seq and RNA-Seq in Zeugodacus tau

Frontiers in Cell and Developmental Biology
Introduction:Zeugodacus tau (Walker) is an invasive pest. An effective method to control this pest is the sterile insect technique (SIT). To better apply this technique, it is necessary to understand testis development progression.Methods: Differentially
Peipei Liu, Peipei Liu, Peipei Liu, Peipei Liu, Peipei Liu, Ziniu Li, Ziniu Li, Ziniu Li, Ziniu Li, Ziniu Li, Qiuyuan Zhang, Qiuyuan Zhang, Qiuyuan Zhang, Qiuyuan Zhang, Qiuyuan Zhang, Jiao Qiao, Jiao Qiao, Jiao Qiao, Jiao Qiao, Jiao Qiao, Chenjun Zheng, Chenjun Zheng, Chenjun Zheng, Chenjun Zheng, Chenjun Zheng, Wenping Zheng, Wenping Zheng, Wenping Zheng, Wenping Zheng, Wenping Zheng, Hongyu Zhang, Hongyu Zhang, Hongyu Zhang, Hongyu Zhang, Hongyu Zhang   +34 more
doaj   +1 more source

Investigating the role of gap junction protein and novel genes in renal function [PDF]

This thesis investigates the roles of genes with enriched expression in particular cells or regions of the Drosophila melanogaster Malpighian tubules in renal function and cellular homeostasis.
Bai, Xueying
core   +1 more source

Innexins in the lobster stomatogastric nervous system: cloning, phylogenetic analysis, developmental changes and expression within adult identified dye and electrically coupled neurons

, 2006
Gap junctions play a key role in the operation of neuronal networks by enabling direct electrical and metabolic communication between neurons. Suitable models to investigate their role in network operation and plasticity are invertebrate motor networks ...
Jonathan Bacon (4460323), E Ducret (16106306), Y Le Feuvre (16106309), V S Fénelon (16106318), H Alexopoulos (16067462), P Meyrand (16106315), J A Davies (16106312)   +6 more
core  

Morphological Observation and Transcriptome Analysis of Ciliogenesis in Urechis unicinctus (Annelida, Echiura). [PDF]

Int J Mol Sci, 2023
Kong D, Wei M, Liu D, Zhang Z, Ma Y, Zhang Z.   +5 more
europepmc   +1 more source

Gap junction innexin asymmetry in C. elegans suggests a diode blocking mechanism to prevent antidromic backpropagation from motor neurons to command interneurons. [PDF]

MicroPubl Biol
White J.
europepmc   +1 more source

Frazzled/DCC Regulates Gap Junction Formation at a <i>Drosophila</i> Giant Synapse. [PDF]

eNeuro
Lopez J, Boerner J, Robbins K, Pena RFO, Murphey R, Murphey R.   +5 more
europepmc   +1 more source

AFD thermosensory neurons mediate tactile-dependent locomotion modulation in <i>C. elegans</i>. [PDF]

Elife
Rosero M, Bai J.
europepmc   +1 more source

"Omics" data unveil early molecular response underlying limb regeneration in the Chinese mitten crab, Eriocheir sinensis. [PDF]

Sci Adv, 2022
Wang J, Chen X, Hou X, Hou X, Wang J, Yue W, Huang S, Xu G, Yan J, Lu G, Hofreiter M, Li C, Wang C.   +12 more
europepmc   +1 more source