Results 111 to 120 of about 319,008 (372)
Genetics and Molecular Biology, 2000 The present study is a revision of our work on evolutionary cytogenetics of the genus Zea, including several new experiments which give a deeper insight into the nature of the DNA sequences involved in telomeric regions of Zea luxurians.
Lidia Poggio +4 more
doaj +1 more source
Amplification and sequencing of Short Tandem Repeats v1
, 2019 To depict the variability among strains 2 STRs viz., GT6 and TA11CA3 region were amplified. All PCR reactions were carried out in 50μl total volume with 100 pmol of each primer and approximately 20 ng of template DNA. PCR reactions were performed on a Master cycler gradient using the primers 5’CCTATCGATCTATGGCTTCC3’ (forward) and 5 ...
Partha Sarathi Mohanty +7 more
openaire +1 more source
Molecular Oncology, EarlyView.The noncoding region of the genome plays a key role in regulating gene expression, and mutations within these regions are capable of altering it. Researchers have identified multiple functional noncoding mutations associated with increased cancer risk in the genome of breast cancer patients.
Arnau Cuy Saqués +3 more
wiley +1 more source
Identification of precursor transcripts for 6 novel miRNAs expands the diversity on the genomic organisation and expression of miRNA genes in rice [PDF]
, 2008 The plant miRNAs represent an important class of endogenous small RNAs that guide cleavage of an mRNA target or repress its translation to control development and adaptation to stresses.
Bangratz, Martine +15 more
core +1 more source
ATF4‐mediated stress response as a therapeutic vulnerability in chordoma
Molecular Oncology, EarlyView.We screened 5 chordoma cell lines against 100+ inhibitors of epigenetic and metabolic pathways and kinases and identified halofuginone, a tRNA synthetase inhibitor. Mechanistically halofuginone induces an integrated stress response, with eIF2alpha phosphorylation, activation of ATF4 and its target genes CHOP, ASNS, INHBE leading to cell death ...
Lucia Cottone +11 more
wiley +1 more source
Bioinform., 2019 Motivation Pacific Biosciences (PacBio) and Oxford Nanopore Technologies (ONT) sequencing technologies can produce long-reads up to tens of kilobases, but with high error rates.
Yan Gao, Bo Liu, Yadong Wang, Yi Xing
semanticscholar +1 more source
Molecular Oncology, EarlyView.The cancer problem is increasing globally with projections up to the year 2050 showing unfavourable outcomes in terms of incidence and cancer‐related deaths. The main challenges are prevention, improved therapeutics resulting in increased cure rates and enhanced health‐related quality of life.
Ulrik Ringborg +43 more
wiley +1 more source
Peroxidasin enables melanoma immune escape by inhibiting natural killer cell cytotoxicity
Molecular Oncology, EarlyView.Peroxidasin (PXDN) is secreted by melanoma cells and binds the NK cell receptor NKG2D, thereby suppressing NK cell activation and cytotoxicity. PXDN depletion restores NKG2D signaling and enables effective NK cell–mediated melanoma killing. These findings identify PXDN as a previously unrecognized immune evasion factor and a potential target to improve
Hsu‐Min Sung +17 more
wiley +1 more source
The Plant Journal, 2019 Summary Amplification of monomer sequences into long contiguous arrays is the main feature distinguishing satellite DNA from other tandem repeats, yet it is also the main obstacle in its investigation because these arrays are in principle difficult to ...
Tihana Vondrak +5 more
semanticscholar +1 more source
Molecular Oncology, EarlyView.Single circulating tumor cells (sCTCs) from high‐grade serous ovarian cancer patients were enriched, imaged, and genomically profiled using WGA and NGS at different time points during treatment. sCTCs revealed enrichment of alterations in Chromosomes 2, 7, and 12 as well as persistent or emerging oncogenic CNAs, supporting sCTC identity.
Carolin Salmon +9 more
wiley +1 more source