Results 31 to 40 of about 2,239 (225)

The lipid metabolism in THRAUSTOCHYTRIDS.

Progress in Lipid Research, 2019
Thraustochytrids are unicellular heterotrophic marine protists of the Stramenopile group, often considered as non-photosynthetic microalgae. They have been isolated from a wide range of habitats including deep sea, but are mostly present in waters rich in sediments and organic materials.
Christian Morabito, Caroline Bournaud, Cécile Maës, Martin Schuler, R. A. Cigliano, Younès Dellero, E. Maréchal, A. Amato, F. Rébeillé   +8 more
semanticscholar   +6 more sources

Genetic Analysis of Polyunsaturated Fatty Acids Biosynthesis Pathway Determines Four Distinct Thraustochytrid Types. [PDF]

Environ Microbiol
Thraustochytrids exhibit four distinct polyunsaturated fatty acid (PUFA) biosynthetic types: Type I (ELO/DES pathway), Type II (dual‐pathway) and Types III–IV (PUFA‐S pathway with varying gene losses). This genetic diversity in PUFA biosynthesis pathways provides new perspectives for understanding their evolutionary relationships and potential ...
Cheng SY, Chen YJ, Lin HC, Chang HY, Huang MD.   +4 more
europepmc   +2 more sources

Single-Cell Oils from Oleaginous Microorganisms as Green Bio-Lubricants: Studies on Their Tribological Performance

Energies, 2021
Biolubricants refer to eco-friendly, biodegradable, and non-toxic lubricants. Their applications are still limited compared to mineral oils; however, their sustainable credentials are making them increasingly attractive.
Alok Patel, Liwen Mu, Yijun Shi, Ulrika Rova, Paul Christakopoulos, Leonidas Matsakas   +5 more
doaj   +1 more source

Screening of a Thraustochytrid Strain Collection for Carotenoid and Squalene Production Characterized by Cluster Analysis, Comparison of 18S rRNA Gene Sequences, Growth Behavior, and Morphology

Marine Drugs, 2023
Carotenoids and squalene are important terpenes that are applied in a wide range of products in foods and cosmetics. Thraustochytrids might be used as alternative production organisms to improve production processes, but the taxon is rarely studied.
Inga K. Koopmann, Bettina A. Müller, Antje Labes   +2 more
doaj   +1 more source

Ecological Dynamics of Two Distinct Viruses Infecting Marine Eukaryotic Decomposer Thraustochytrids (Labyrinthulomycetes, Stramenopiles). [PDF]

PLoS ONE, 2015
Thraustochytrids are cosmopolitan osmotrophic or heterotrophic microorganisms that are considered as important decomposers in coastal ecosystems. However, because of a lack of estimation method for each genus or systematic group of them, relatively ...
Yoshitake Takao, Yuji Tomaru, Keizo Nagasaki, Daiske Honda   +3 more
doaj   +1 more source

Engineering xylose metabolism in thraustochytrid T18 [PDF]

Biotechnology for Biofuels, 2018
Thraustochytrids are heterotrophic, oleaginous, marine protists with a significant potential for biofuel production. High-value co-products can off-set production costs; however, the cost of raw materials, and in particular carbon, is a major challenge to developing an economical viable production process.
Alexandra Merkx-Jacques, Holly Rasmussen, Denise M. Muise, Jeremy J. R. Benjamin, Haila Kottwitz, Kaitlyn Tanner, Michael T. Milway, Laura M. Purdue, Mark A. Scaife, Roberto E. Armenta, David L. Woodhall   +10 more
openaire   +3 more sources

Novel lysophospholipid acyltransferase PLAT1 of Aurantiochytrium limacinum F26-b responsible for generation of palmitate-docosahexaenoate-phosphatidylcholine and phosphatidylethanolamine. [PDF]

PLoS ONE, 2014
N-3 polyunsaturated fatty acids (PUFA), such as docosahexaenoic acid (DHA, 22:6n-3), have been reported to play roles in preventing cardiovascular diseases.
Eriko Abe, Kazutaka Ikeda, Eri Nutahara, Masahiro Hayashi, Atsushi Yamashita, Ryo Taguchi, Kosaku Doi, Daiske Honda, Nozomu Okino, Makoto Ito   +9 more
doaj   +1 more source

Two thraustochytrid 5S ribosomal RNAs

Nucleic Acids Research, 1982
The complete nucleotide sequences of the 5S ribosomal RNAs (rRNAs) of two thraustochytrids, Thraustochytrium visurgense and Schizochytrium, aggregatum, are AUGAGCCCUCAUAUCAUGUGGAGUGCACCGGAUCUCAUCCGAACUCCGUAGUUAAGCCACAUAGAGCGCGUC UAGUACUGCCGUAGGGGACUAGGUGGGAAGCACGCGUGGGGCUCAUU and ACAGCCGUUCAUACCACACGGAGA ...
R M, MacKay, W F, Doolittle
openaire   +3 more sources

Thraustochytrids (fungoid protist): an unexplored component of marine sediment microbiota

Scientia Marina, 2004
Thraustochytrids are poorly known fungoid protists able to decompose refractory organic substrates such as cellulose. These microorganisms probably play an important role in the microbial loop of marine sediments.
Lucia Bongiorni, Lucrezia Pignataro, Giovanni Santangelo   +2 more
doaj   +1 more source

Abundance of thraustochytrids in coastal plankton [PDF]

Marine Ecology Progress Series, 1998
The abundance of thraustochytrids was investigated in and off the Seto Inland Sea, Japan. Thraustochytrid cells were stained with acriflavine and counted directly by epifluorescence rnicroscopy. Thraustochytrids were present in the water column at a density of 2.1 X 103 to 5.6 X 10' cells I-', with an overall average of 1.0 X 104 cells I-', which was ...
T Naganuma, H Takasugi, H Kimura
openaire   +1 more source