Results 41 to 50 of about 1,064 (192)
Marine Drugs, 2021 Schizochytrium species are one of the best oleaginous thraustochytrids for high-yield production of docosahexaenoic acid (DHA, 22:6). However, the DHA yields from most wild-type (WT) strains of Schizochytrium are unsatisfactory for large-scale production.
Lu Liu +6 more
doaj +1 more source
Prokaryotic PfaB is a terminal acyltransferase that determines the final PUFA product. [PDF]
Protein SciAbstract Omega‐3 polyunsaturated fatty acids (PUFAs) are essential for human health due to their numerous beneficial biological properties. These compounds are synthesized in marine bacteria and eukaryotic microalgae by PUFA megasynthases (Pfas), which are evolutionarily related to fatty acid synthases (FAS) and polyketide synthases (PKS). In FAS, PKS,
Lofeudo N +5 more
europepmc +2 more sources
Biomass of thraustochytrid protoctists in coastal water [PDF]
Marine Ecology Progress Series, 1999 Abundance, cellular contents of carbon and nitrogen, and C/N ratio of planktonic thraustochytrids in the Seto Inland Sea and the coastal Hyuga-nada, Japan, were determined. Thraustochytrid cells were stained with acriflavine and counted directly by epifluorescence microscopy.
H Kimura, T Fukuba, T Naganuma
openaire +1 more source
Two thraustochytrid 5S ribosomal RNAs
Nucleic Acids Research, 1982 The complete nucleotide sequences of the 5S ribosomal RNAs (rRNAs) of two thraustochytrids, Thraustochytrium visurgense and Schizochytrium, aggregatum, are AUGAGCCCUCAUAUCAUGUGGAGUGCACCGGAUCUCAUCCGAACUCCGUAGUUAAGCCACAUAGAGCGCGUC UAGUACUGCCGUAGGGGACUAGGUGGGAAGCACGCGUGGGGCUCAUU and ACAGCCGUUCAUACCACACGGAGA ...
R M, MacKay, W F, Doolittle
openaire +3 more sources
Journal of Lipid Research, 2012 Thraustochytrids are known to synthesize PUFAs such as docosahexaenoic acid (DHA). Accumulating evidence suggests the presence of two synthetic pathways of PUFAs in thraustochytrids: the polyketide synthase-like (PUFA synthase) and desaturase/elongase ...
Takanori Matsuda +11 more
doaj +1 more source
Bioprocess Potentials of Squalene from Thraustochytrids Microalgae for Nutraceuticals in New Normal Era Isolated from Indonesian Mangroves: A Review [PDF]
, 2021 The covid-19 pandemic has been increasing people's awareness of good eating habits and consumption to maintain their health. Accordingly, the choice shifted more to consume nutraceutical and functional food to provide a beneficial impact.
Sulistiawati, Endah +9 more
core +1 more source
Marine Drugs, 2021 The Labyrinthulomycetes or Labyrinthulea are a class of protists that produce a network of filaments that enable the cells to glide along and absorb nutrients.
Kim Jye Lee-Chang +6 more
doaj +1 more source
Seasonal dynamics of thraustochytrids in mangrove rhizospheres for microbial interactions, PUFA production. [PDF]
Sci RepThis study investigated seasonal variations of thraustochytrids in rhizosphere soil collected from two mangrove species Rhizophora apiculata and Avicennia marina in natural and planted mangrove stands.
Kaliyamoorthy K +5 more
europepmc +2 more sources
How do algae oils change the omega-3 polyunsaturated fatty acids market?☆
Oilseeds and fats, crops and lipids, 2022 The health benefits of a diet rich in omega-3 long chain polyunsaturated fatty acids (n-3 LC-PUFA) no longer need to be proven. However, while health authorities attempt to increase the consumption of the n-3 LC-PUFAs eicosapentaenoic acid (EPA) and ...
Sehl Anthony +5 more
doaj +1 more source
Frontiers in Nutrition, 2022 Thraustochytrids, such as Aurantiochytrium and Schizochytrium, have been shown as a promising sustainable alternative to fish oil due to its ability to accumulate a high level of docosahexaenoic acid (DHA) from its total fatty acids. However, the low DHA
Yusuf Nazir +9 more
doaj +1 more source