Results 71 to 80 of about 87,488 (261)

TRAIL‐PEG‐Apt‐PLGA nanosystem as an aptamer‐targeted drug delivery system potential for triple‐negative breast cancer therapy using in vivo mouse model

Molecular Oncology, EarlyView.
Aptamers are used both therapeutically and as targeting agents in cancer treatment. We developed an aptamer‐targeted PLGA–TRAIL nanosystem that exhibited superior therapeutic efficacy in NOD/SCID breast cancer models. This nanosystem represents a novel biotechnological drug candidate for suppressing resistance development in breast cancer.
Gulen Melike Demirbolat, Aslihan Kucuk, Omer Erdogan, Samed Ozer, Bensu Kozan, Tugba Cuceli, Erkan Gumus, Evrim Cevik, Ozge Cevik   +8 more
wiley   +1 more source

Evolutionary relationships in the genus Zea: analysis of repetitive sequences used as cytological FISH and GISH markers

Genetics and Molecular Biology, 2000
The present study is a revision of our work on evolutionary cytogenetics of the genus Zea, including several new experiments which give a deeper insight into the nature of the DNA sequences involved in telomeric regions of Zea luxurians.
Lidia Poggio, Viviana Confalonieri, Cecilia Comas, Graciela Gonzalez, Carlos A. Naranjo   +4 more
doaj   +1 more source

Amplification and sequencing of Short Tandem Repeats v1

, 2019
To depict the variability among strains 2 STRs viz., GT6 and TA11CA3 region were amplified. All PCR reactions were carried out in 50μl total volume with 100 pmol of each primer and approximately 20 ng of template DNA. PCR reactions were performed on a Master cycler gradient using the primers 5’CCTATCGATCTATGGCTTCC3’ (forward) and 5 ...
Partha Sarathi Mohanty, Avi Kumar Bansal, Farah Naaz, Mamta Arora, Umesh Datta Gupta, Pushpa Gupta, Sandeep Sharma, Haribhan Singh   +7 more
openaire   +1 more source

Correlation of the differential expression of PIK3R1 and its spliced variant, p55α, in pan‐cancer

Molecular Oncology, EarlyView.
PIK3R1 undergoes alternative splicing to generate the isoforms, p85α and p55α. By combining large patient datasets with laboratory experiments, we show that PIK3R1 spliced variants shape cancer behavior. While tumors lose the protective p85α isoform, p55α is overexpressed, changes linked to poorer survival and more pronounced in African American ...
Ishita Gupta, Yang Song, Madeleine Ndahayo, Anirudh Saxena, Theresa Guo, Dylan Z. Kelley, Jessica Gore, Andrew Hennigan, Alexa Anderson, John C. Papadimitriou, Daria A. Gaykalova   +10 more
wiley   +1 more source

Colorectal cancer‐derived FGF19 is a metabolically active serum biomarker that exerts enteroendocrine effects on mouse liver

Molecular Oncology, EarlyView.
Meta‐transcriptome analysis identified FGF19 as a peptide enteroendocrine hormone associated with colorectal cancer prognosis. In vivo xenograft models showed release of FGF19 into the blood at levels that correlated with tumor volumes. Tumoral‐FGF19 altered murine liver metabolism through FGFR4, thereby reducing bile acid synthesis and increasing ...
Jordan M. Beardsley, Michael W. Rohr, Joseph A. Goode, Sai Preethi Nakkina, Jignesh G. Parikh, Deborah A. Altomare   +5 more
wiley   +1 more source

Targeted modulation of IGFL2‐AS1 reveals its translational potential in cervical adenocarcinoma

Molecular Oncology, EarlyView.
Cervical adenocarcinoma patients face worse outcomes than squamous cell carcinoma counterparts despite similar treatment. The identification of IGFL2‐AS1's differential expression provides a molecular basis for distinguishing these histotypes, paving the way for personalized therapies and improved survival in vulnerable populations globally.
Ricardo Cesar Cintra, Lucca Paolo Hsu Helmich, Daniel Rodrigues de Bastos, Laura Sichero, Patrícia Savio de Araujo‐Souza, Fabio Passetti, Luisa Lina Villa   +6 more
wiley   +1 more source

Local Tandem Repeat Expansion in Xist RNA as a Model for the Functionalisation of ncRNA

Non-Coding RNA, 2018
Xist, the master regulator of the X chromosome inactivation in mammals, is a 17 kb lncRNA that acts in cis to silence the majority of genes along the chromosome from which it is transcribed.
Neil Brockdorff
doaj   +1 more source

COMP–PMEPA1 axis promotes epithelial‐to‐mesenchymal transition in breast cancer cells

Molecular Oncology, EarlyView.
This study reveals that cartilage oligomeric matrix protein (COMP) promotes epithelial‐to‐mesenchymal transition (EMT) in breast cancer. We identify PMEPA1 (protein TMEPAI) as a novel COMP‐binding partner that mediates EMT via binding to the TSP domains of COMP, establishing the COMP–PMEPA1 axis as a key EMT driver in breast cancer.
Konstantinos S. Papadakos, Gilar Gorji‐bahri, Lejla Gradjan, Julia Zajac, Kacper Gil, Yvonne Thokozile Nduku, Anna M. Blom   +6 more
wiley   +1 more source

Keratin 19 as a prognostic marker and contributing factor of metastasis and chemoresistance in high‐grade serous ovarian cancer

Molecular Oncology, EarlyView.
Keratin 19 (KRT19) is overexpressed in high‐grade serous ovarian cancer with high levels of Kallikrein‐related peptidases (KLK) 4–7 and is associated with poor survival. In vivo analyses demonstrate that elevated KRT19 increases peritoneal tumour burden.
Sophia Bielesch, Isabel Vogel, Sina Nokodian, Johanna Moeller, Antonia Blechschmidt, Vicky Hecht, Vanessa Kuentzel, Katharina Thiedig, Melissa Schwab, Oliver Schilling, Holger Bronger, Marion Kiechle, Viktor Magdolen, Tobias Dreyer   +13 more
wiley   +1 more source

Domain associated with zinc fingers‐containing NF90‐NF45 complex inhibits m6A modification of primary microRNA by suppressing METTL3/14 activity

FEBS Open Bio, EarlyView.
NF90–NF45 functions as a negative regulator of methyltransferase‐like 3/14 (METTL3/14)‐mediated N6‐methyladenosine (m6A) modification on primary microRNAs (pri‐miRNAs). NF90–NF45 binds to anti‐oncogenic pri‐miRNAs and inhibits their m6A modification, thereby suppressing the biogenesis of anti‐oncogenic miRNAs.
Takuma Higuchi, Shunsuke Morioka, Keiko Morisawa, Kazutsugu Matsukawa, Shingo Ashida, Takeshi Suzuki, Shuji Sakamoto   +6 more
wiley   +1 more source