Results 51 to 60 of about 90,014 (157)
BMC Plant Biology, 2021 Background Although plastomes are highly conserved with respect to gene content and order in most photosynthetic angiosperms, extensive genomic rearrangements have been reported in Fabaceae, particularly within the inverted repeat lacking clade (IRLC) of
Shuang Wu +8 more
doaj +1 more source
ULTRA-effective labeling of tandem repeats in genomic sequence
Bioinformatics AdvancesAbstract In the age of long read sequencing, genomics researchers now have access to accurate repetitive DNA sequence (including satellites) that, due to the limitations of short read-sequencing, could previously be observed only as unmappable fragments.
Daniel R Olson, Travis J Wheeler
openaire +2 more sources
Genetics and Molecular Biology, 2000 The present study is a revision of our work on evolutionary cytogenetics of the genus Zea, including several new experiments which give a deeper insight into the nature of the DNA sequences involved in telomeric regions of Zea luxurians.
Lidia Poggio +4 more
doaj +1 more source
Amplification and sequencing of Short Tandem Repeats v1
, 2019 To depict the variability among strains 2 STRs viz., GT6 and TA11CA3 region were amplified. All PCR reactions were carried out in 50μl total volume with 100 pmol of each primer and approximately 20 ng of template DNA. PCR reactions were performed on a Master cycler gradient using the primers 5’CCTATCGATCTATGGCTTCC3’ (forward) and 5 ...
Partha Sarathi Mohanty +7 more
openaire +1 more source
Local Tandem Repeat Expansion in Xist RNA as a Model for the Functionalisation of ncRNA
Non-Coding RNA, 2018 Xist, the master regulator of the X chromosome inactivation in mammals, is a 17 kb lncRNA that acts in cis to silence the majority of genes along the chromosome from which it is transcribed.
Neil Brockdorff
doaj +1 more source
A New Model for Finding Approximate Tandem Repeats in DNA Sequences
Journal of Software, 2011 In gene analysis, finding approximate tandem repe at s in DNA sequence is an important issue . SUA_SATR is one of the latest methods for finding those repetitions, which suffers deficiencies of runtime cost and poor result quality. In order to detect approximate tandem repeats in genomic sequences more efficiently, we propose a ...
Jiang, Qingshan +3 more
openaire +2 more sources
Detection of Recombination in Variable Number Tandem Repeat Sequences
S. Afr. Comput. J., 2007 Tandem repeats are repeated sequences whose copies are adjacent along the chromosomes. They account for large portion of eukaryotic genomes and are found in all types of living organisms. Among tandem repeats, those with repeat unit of middle size are called minisatellites. These loci depart from classical loci because of the propensity to vary in size
Adebiyi, Ezekiel, Rivals, Eric
openaire +2 more sources
Genotyping of IRGM tetranucleotide promoter oligorepeats by fluorescence resonance energy transfer
BioTechniques, 2009 Fluorescence resonance energy transfer (FRET) genotyping has been well established for the rapid assessment of single nucleotide polymorphisms (SNPs) and deletions. A design is presented that allows the typing of short tandem oligo repeat sequences using
Christopher D. Intemann +5 more
doaj +1 more source
HorticulturaeTandem repeats in eukaryotic genomes exhibit intrinsic instability that drives rapid evolutionary diversification. However, their evolutionary dynamics in allopolyploid species such as the water hyacinth (Pontederia crassipes or Eichhornia crassipes ...
Liqing Feng +5 more
doaj +1 more source
Mammalian TBX1 preferentially binds and regulates downstream targets via a tandem T-site repeat.
PLoS ONE, 2014 Haploinsufficiency or mutation of TBX1 is largely responsible for the etiology of physical malformations in individuals with velo-cardio-facial/DiGeorge syndrome (VCFS/DGS/22q11.2 deletion syndrome).
Raquel Castellanos +4 more
doaj +1 more source