Results 91 to 100 of about 178,982 (291)

Gold nanoparticle-based colorimetric detection of kanamycin using a DNA aptamer

, 2018
A selective kanamycin-binding single-strand DNA (ssDNA) aptamer (TGGGGGTTGAGGCTAAGCCGA) was discovered through in vitro selection using affinity chromatography with kanamycin-immobilized sepharose beads.
Song, KM, Kim, T, Han, MS, Ban, C, Jo, H, Min, K, Jeon, SH, Cho, M, Ku, JK   +8 more
core   +1 more source

Development of Structure-Switching Aptamers for Kanamycin Detection Based on Fluorescence Resonance Energy Transfer [PDF]

, 2019
The structure-switching aptamers are designed for the simple and rapid detection of kanamycin based on the signal transduction principle of fluorescence resonance energy transfer (FRET).
Xinyue Ma, Mingdi Zhang, Hongjing Sun, Chunyan Sun, Shangna Qiao, Ruifang Su   +5 more
core   +1 more source

Microbial sensor system for rapid kanamycin detection in conducting solutions

, 2023
Use of large numbers of antibacterial drugs leads to increased pollution of the environment, especially water resources. Therefore, it is important to devise methods for the rapid detection and determination of antibiotics in aqueous solutions.
О.А. Karavaeva, B.D. Zaitsev, А.А. Shirokov, О.I. Guliy, A.A. Teplykh, I.A. Borodina   +5 more
core   +1 more source

Continuous Evolution System Based on Toxin–Antitoxin System Combined with Base Deaminase Accelerates the In Vivo Modification of Target Proteins

Advanced Science, EarlyView.
The promoted Escherichia coli‐assisted continuous evolution (PEACE) system operates through a stringent three step genetic circuit: target gene mutation via a deaminase–T7 RNA polymerase (T7 RNAP) fusion, coupling variant function to antitoxin expression, and growth based selection of surviving cells.
Xinyu Zhang, Zhanzhi Liu, Ying Xu, Mingjing Sun, Guangzhen Zhou, Deming Rao, Xiaoqian Chen, Sheng Wang, Zhigang Li, Yan Huang, Jing Wu   +10 more
wiley   +1 more source

Ultrasensitive and Real-Time Detection of Kanamycin Residues in Milk Using an Aptasensor Based on Microfluidic Capacitive Strategy

Biosensors
Kanamycin (KanR) is a widely used antibiotic in human and veterinary medicine, as well as in food production and livestock breeding. However, its environmental residue and bioaccumulation in the food chain pose a great threat to human health. A real-time
Weidong Zheng, Jun Chai, Jayne Wu, Jian Zhang, Haochen Qi   +4 more
doaj   +1 more source

Endothelial miR‐15a/16‐1 Regulation of SYNE1 Mediates Structural and Functional Recovery after Traumatic Brain Injury

Advanced Science, EarlyView.
Endothelial miR‐15a/16‐1 deletion promotes long‐term recovery after traumatic brain injury by restoring SYNE1 expression. Enhanced endothelial SYNE1 preserves vascular integrity, protects white and gray matter, and improves neurological function. The endothelial miR‐15a/16‐1–SYNE1 axis emerges as a key regulator of neurovascular repair and a potential ...
Shun Li, Na Qiu, Chao Zhou, Andrew Ni, Ping Sun, Jia‐Jun Liu, Xin‐Lei Huang, Tian‐Qing Xiong, Yu‐Chi Zhang, Hai‐Zhou Liu, Xiao‐Tao Xu, Rui Wang, Shi‐Qing Zhang, Yu‐Xin Zhang, Silvia Liu, C. Edward Dixon, Jun Chen, Ke‐Jie Yin   +17 more
wiley   +1 more source

Novel Peptide Vaccine GV1001 Rescues Hearing in Kanamycin/Furosemide-Treated Mice

Frontiers in Cellular Neuroscience, 2018
The cell-penetrating peptide GV1001 has been investigated as an anticancer agent and recently demonstrated anti-oxidant and anti-inflammatory effects. It has shown a protective effect on a kanamycin (KM)-induced ototoxicity mouse model.
Shin Hye Kim, Gaon Jung, Sangjae Kim, Ja-Won Koo, Ja-Won Koo   +4 more
doaj   +1 more source

Deep Learning‐Driven Discovery and Engineering of an Efficient PETase for Depolymerization and Detoxification of PET Microplastics Under Physiological Conditions

Advanced Science, EarlyView.
A deep learning–driven pipeline mining 246 million protein sequences uncovers AhPETase, an evolutionarily distinct PET hydrolase. Engineered variant AhPETaseM1 degrades post‐consumer PET microplastics under physiological conditions and reverses microplasticinduced cytotoxicity in human lung and colon cells, establishing enzymatic microplastic ...
Yuxuan Wang, Shijie He, Yuheng Chang, Sheng Mao, Jianan Canal Li, Binbin Chen, Hongxun Gao, Mingchun Xu, Chenxu Liu, Yajie Wang   +9 more
wiley   +1 more source

An Overview on Recent Progress in Electrochemical Biosensors for Antimicrobial Drug Residues in Animal-Derived Food

Sensors, 2017
Anti-microbial drugs are widely employed for the treatment and cure of diseases in animals, promotion of animal growth, and feed efficiency. However, the scientific literature has indicated the possible presence of antimicrobial drug residues in animal ...
Marjan Majdinasab, Mustansara Yaqub, Abdur Rahim, Gaelle Catanante, Akhtar Hayat, Jean Louis Marty   +5 more
doaj   +1 more source

ISAba1‐mediated crp‐osmC amplification enhances host‐associated fitness in Acinetobacter baumannii [PDF]

mLife
Abstract Acinetobacter baumannii is a pathogen, highly adaptable to both hospital‐ and host‐associated environments. Understanding the genetic mechanisms underlying its adaptability is critical for controlling its persistence. Our study identified the crp‐osmC gene cluster, flanked by ISAba1 elements, as a significant genetic structure undergoing ...
Wei D, Huang J, Fang H, Wang X, Zhang G, Wang C, Song Y, Feng J.   +7 more
europepmc   +2 more sources